EMAIL THIS PAGE TO A FRIEND

WDR55

WD repeat domain 55

UniProtKB ID: Q9H6Y2, Q9NXK4
Gene ID:
Mouse(67936) WD repeat domain 55
Rat(307494) WD repeat domain 55
Zebrafish(445394) WD repeat domain 55
domestic cat(101096872) WD repeat domain 55
dog(478033) WD repeat domain 55
chicken(100858589) WD repeat domain 55
cow(508709) WD repeat domain 55
sheep(101119983) WD repeat domain 55
domestic guinea pig(100728278) WD repeat domain 55
naked mole-rat(101711488) WD repeat domain 55
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017706 Rosetta Predictions human pricing
NM_001017932 Rosetta Predictions rat pricing
NM_026464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066657 predicted 715
2 SASI_Hs01_00066658 predicted 852
3 SASI_Hs01_00066660 predicted 431
4 SASI_Hs01_00066661 predicted 701
5 SASI_Hs01_00066663 predicted 468
6 SASI_Hs01_00066664 predicted 396
7 SASI_Hs01_00066665 predicted 584
8 SASI_Hs02_00350465 predicted 226
9 SASI_Hs01_00066666 predicted 308
10 SASI_Hs02_00350466 predicted 874
11 SASI_Hs01_00066659 predicted 304
12 SASI_Hs01_00066662 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092237 predicted 285
2 SASI_Rn01_00092238 predicted 383
3 SASI_Rn01_00092239 predicted 1087
4 SASI_Rn01_00092242 predicted 1262
5 SASI_Rn01_00092243 predicted 781
6 SASI_Rn01_00092244 predicted 1050
7 SASI_Rn02_00202357 predicted 904
8 SASI_Rn02_00202358 predicted 373
9 SASI_Rn02_00202359 predicted 1271
10 SASI_Rn01_00092245 predicted 429
11 SASI_Rn01_00092240 predicted 789
12 SASI_Rn01_00092241 predicted 1312
13 SASI_Rn01_00092246 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182036 predicted 1254
2 SASI_Mm01_00182037 predicted 248
3 SASI_Mm01_00182038 predicted 754
4 SASI_Mm01_00182039 predicted 364
5 SASI_Mm01_00182040 predicted 388
6 SASI_Mm01_00182041 predicted 871
7 SASI_Mm01_00182042 predicted 333
8 SASI_Mm01_00182043 predicted 818
9 SASI_Mm01_00182044 predicted 1048
10 SASI_Mm01_00182045 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026464
VALIDATED
WDR55 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 55
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-825s1c1
Sequence:CCGGGCATAGTTCCAGTCACTGAGACTCGAGTCTCAGTGACTGGAACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026464.2-1307s1c1
Sequence:CCGGGCTCAGCTCTACCACTGATTACTCGAGTAATCAGTGGTAGAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-812s1c1
Sequence:CCGGGAGTCCATCGACTGCATAGTTCTCGAGAACTATGCAGTCGATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026464.2-343s1c1
Sequence:CCGGGAAACTTGTTACCGTCTCTAACTCGAGTTAGAGACGGTAACAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-625s1c1
Sequence:CCGGCCTTGGTGTCTTCAACATCAACTCGAGTTGATGTTGAAGACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-703s1c1
Sequence:CCGGCCTCATGAAATACGGGAAGAACTCGAGTTCTTCCCGTATTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-355s1c1
Sequence:CCGGCGTCTCTAAGGACAAAGCAATCTCGAGATTGCTTTGTCCTTAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026464.2-376s1c1
Sequence:CCGGCCACATCTTAGATGTCGAACACTCGAGTGTTCGACATCTAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026464.2-1278s1c1
Sequence:CCGGGATTGAACCTACCACCTTGAACTCGAGTTCAAGGTGGTAGGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-399s1c1
Sequence:CCGGGACAATTGGAAAGGCGAATTTCTCGAGAAATTCGCCTTTCCAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-343s21c1
Sequence:CCGGGAAACTTGTTACCGTCTCTAACTCGAGTTAGAGACGGTAACAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026464.2-625s21c1
Sequence:CCGGCCTTGGTGTCTTCAACATCAACTCGAGTTGATGTTGAAGACACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-355s21c1
Sequence:CCGGCGTCTCTAAGGACAAAGCAATCTCGAGATTGCTTTGTCCTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-703s21c1
Sequence:CCGGCCTCATGAAATACGGGAAGAACTCGAGTTCTTCCCGTATTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-376s21c1
Sequence:CCGGCCACATCTTAGATGTCGAACACTCGAGTGTTCGACATCTAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026464
VALIDATED
WDR55 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 55
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-825s1c1
Sequence:CCGGGCATAGTTCCAGTCACTGAGACTCGAGTCTCAGTGACTGGAACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026464.2-1307s1c1
Sequence:CCGGGCTCAGCTCTACCACTGATTACTCGAGTAATCAGTGGTAGAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-812s1c1
Sequence:CCGGGAGTCCATCGACTGCATAGTTCTCGAGAACTATGCAGTCGATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026464.2-343s1c1
Sequence:CCGGGAAACTTGTTACCGTCTCTAACTCGAGTTAGAGACGGTAACAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-625s1c1
Sequence:CCGGCCTTGGTGTCTTCAACATCAACTCGAGTTGATGTTGAAGACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-703s1c1
Sequence:CCGGCCTCATGAAATACGGGAAGAACTCGAGTTCTTCCCGTATTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-355s1c1
Sequence:CCGGCGTCTCTAAGGACAAAGCAATCTCGAGATTGCTTTGTCCTTAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026464.2-376s1c1
Sequence:CCGGCCACATCTTAGATGTCGAACACTCGAGTGTTCGACATCTAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026464.2-1278s1c1
Sequence:CCGGGATTGAACCTACCACCTTGAACTCGAGTTCAAGGTGGTAGGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-399s1c1
Sequence:CCGGGACAATTGGAAAGGCGAATTTCTCGAGAAATTCGCCTTTCCAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-343s21c1
Sequence:CCGGGAAACTTGTTACCGTCTCTAACTCGAGTTAGAGACGGTAACAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026464.2-625s21c1
Sequence:CCGGCCTTGGTGTCTTCAACATCAACTCGAGTTGATGTTGAAGACACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-355s21c1
Sequence:CCGGCGTCTCTAAGGACAAAGCAATCTCGAGATTGCTTTGTCCTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-703s21c1
Sequence:CCGGCCTCATGAAATACGGGAAGAACTCGAGTTCTTCCCGTATTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-376s21c1
Sequence:CCGGCCACATCTTAGATGTCGAACACTCGAGTGTTCGACATCTAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026464
VALIDATED
WDR55 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 55
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-825s1c1
Sequence:CCGGGCATAGTTCCAGTCACTGAGACTCGAGTCTCAGTGACTGGAACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026464.2-1307s1c1
Sequence:CCGGGCTCAGCTCTACCACTGATTACTCGAGTAATCAGTGGTAGAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-812s1c1
Sequence:CCGGGAGTCCATCGACTGCATAGTTCTCGAGAACTATGCAGTCGATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026464.2-343s1c1
Sequence:CCGGGAAACTTGTTACCGTCTCTAACTCGAGTTAGAGACGGTAACAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-625s1c1
Sequence:CCGGCCTTGGTGTCTTCAACATCAACTCGAGTTGATGTTGAAGACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-703s1c1
Sequence:CCGGCCTCATGAAATACGGGAAGAACTCGAGTTCTTCCCGTATTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026464.2-355s1c1
Sequence:CCGGCGTCTCTAAGGACAAAGCAATCTCGAGATTGCTTTGTCCTTAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026464.2-376s1c1
Sequence:CCGGCCACATCTTAGATGTCGAACACTCGAGTGTTCGACATCTAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026464.2-1278s1c1
Sequence:CCGGGATTGAACCTACCACCTTGAACTCGAGTTCAAGGTGGTAGGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026464.2-399s1c1
Sequence:CCGGGACAATTGGAAAGGCGAATTTCTCGAGAAATTCGCCTTTCCAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-343s21c1
Sequence:CCGGGAAACTTGTTACCGTCTCTAACTCGAGTTAGAGACGGTAACAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026464.2-625s21c1
Sequence:CCGGCCTTGGTGTCTTCAACATCAACTCGAGTTGATGTTGAAGACACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-355s21c1
Sequence:CCGGCGTCTCTAAGGACAAAGCAATCTCGAGATTGCTTTGTCCTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-703s21c1
Sequence:CCGGCCTCATGAAATACGGGAAGAACTCGAGTTCTTCCCGTATTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026464.2-376s21c1
Sequence:CCGGCCACATCTTAGATGTCGAACACTCGAGTGTTCGACATCTAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017706
VALIDATED
WDR55 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 55
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017706.3-485s1c1
Sequence:CCGGGATGAGAATGTTCTGGCCACTCTCGAGAGTGGCCAGAACATTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017706.3-568s1c1
Sequence:CCGGGAGGCAACATGAAGAGTACATCTCGAGATGTACTCTTCATGTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017706.3-836s1c1
Sequence:CCGGGAATCTATCGACTGCATGGTTCTCGAGAACCATGCAGTCGATAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017706.3-367s1c1
Sequence:CCGGGAAGCTCATTACTGTCTCCAACTCGAGTTGGAGACAGTAATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017706.3-2218s1c1
Sequence:CCGGCGGCCTGGATATGAATTTATACTCGAGTATAAATTCATATCCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017706.3-1293s1c1
Sequence:CCGGCCCAGAGAGGATATGAATTATCTCGAGATAATTCATATCCTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-615s21c1
Sequence:CCGGTGAAGAGTACATCGCAGACATCTCGAGATGTCTGCGATGTACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-755s21c1
Sequence:CCGGCCTCTGTCACTCTCATGAAATCTCGAGATTTCATGAGAGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-809s21c1
Sequence:CCGGGTACCATCTACCTCTTCAATTCTCGAGAATTGAAGAGGTAGATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-1759s21c1
Sequence:CCGGTGCCTGGTAGCTGAGACTTAACTCGAGTTAAGTCTCAGCTACCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-413s21c1
Sequence:CCGGTTACTGTCTCCAAGGACAAAGCTCGAGCTTTGTCCTTGGAGACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017706.4-1300s21c1
Sequence:CCGGCAGGCAAGAGTCTTGCTTATTCTCGAGAATAAGCAAGACTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017706
VALIDATED
WDR55 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 55
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017706.3-485s1c1
Sequence:CCGGGATGAGAATGTTCTGGCCACTCTCGAGAGTGGCCAGAACATTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017706.3-568s1c1
Sequence:CCGGGAGGCAACATGAAGAGTACATCTCGAGATGTACTCTTCATGTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017706.3-836s1c1
Sequence:CCGGGAATCTATCGACTGCATGGTTCTCGAGAACCATGCAGTCGATAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017706.3-367s1c1
Sequence:CCGGGAAGCTCATTACTGTCTCCAACTCGAGTTGGAGACAGTAATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017706.3-2218s1c1
Sequence:CCGGCGGCCTGGATATGAATTTATACTCGAGTATAAATTCATATCCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017706.3-1293s1c1
Sequence:CCGGCCCAGAGAGGATATGAATTATCTCGAGATAATTCATATCCTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-615s21c1
Sequence:CCGGTGAAGAGTACATCGCAGACATCTCGAGATGTCTGCGATGTACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-755s21c1
Sequence:CCGGCCTCTGTCACTCTCATGAAATCTCGAGATTTCATGAGAGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-809s21c1
Sequence:CCGGGTACCATCTACCTCTTCAATTCTCGAGAATTGAAGAGGTAGATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-1759s21c1
Sequence:CCGGTGCCTGGTAGCTGAGACTTAACTCGAGTTAAGTCTCAGCTACCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-413s21c1
Sequence:CCGGTTACTGTCTCCAAGGACAAAGCTCGAGCTTTGTCCTTGGAGACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017706.4-1300s21c1
Sequence:CCGGCAGGCAAGAGTCTTGCTTATTCTCGAGAATAAGCAAGACTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017706
VALIDATED
WDR55 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 55
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017706.3-485s1c1
Sequence:CCGGGATGAGAATGTTCTGGCCACTCTCGAGAGTGGCCAGAACATTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017706.3-568s1c1
Sequence:CCGGGAGGCAACATGAAGAGTACATCTCGAGATGTACTCTTCATGTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017706.3-836s1c1
Sequence:CCGGGAATCTATCGACTGCATGGTTCTCGAGAACCATGCAGTCGATAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017706.3-367s1c1
Sequence:CCGGGAAGCTCATTACTGTCTCCAACTCGAGTTGGAGACAGTAATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017706.3-2218s1c1
Sequence:CCGGCGGCCTGGATATGAATTTATACTCGAGTATAAATTCATATCCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017706.3-1293s1c1
Sequence:CCGGCCCAGAGAGGATATGAATTATCTCGAGATAATTCATATCCTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-615s21c1
Sequence:CCGGTGAAGAGTACATCGCAGACATCTCGAGATGTCTGCGATGTACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-755s21c1
Sequence:CCGGCCTCTGTCACTCTCATGAAATCTCGAGATTTCATGAGAGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-809s21c1
Sequence:CCGGGTACCATCTACCTCTTCAATTCTCGAGAATTGAAGAGGTAGATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-1759s21c1
Sequence:CCGGTGCCTGGTAGCTGAGACTTAACTCGAGTTAAGTCTCAGCTACCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017706.4-413s21c1
Sequence:CCGGTTACTGTCTCCAAGGACAAAGCTCGAGCTTTGTCCTTGGAGACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017706.4-1300s21c1
Sequence:CCGGCAGGCAAGAGTCTTGCTTATTCTCGAGAATAAGCAAGACTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks