EMAIL THIS PAGE TO A FRIEND

WDR59

WD repeat domain 59

UniProtKB ID: Q6PJI9, B3KRC3, Q71RE7, Q96PW5, Q9BSW6, Q9HA43
Gene ID:
Mouse(319481) WD repeat domain 59
Rat(690751) WD repeat domain 59
naked mole-rat(101712692) WD repeat domain 59
domestic guinea pig(100715424) WD repeat domain 59
cow(526642) WD repeat domain 59
sheep(101115392) WD repeat domain 59
chicken(415688) WD repeat domain 59
dog(479653) WD repeat domain 59
Horse(100055157) WD repeat domain 59
domestic cat(101089819) WD repeat domain 59
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071061 MISSION® esiRNA esiRNA human WDR59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030581 Rosetta Predictions human pricing
XR_006941 Rosetta Predictions rat pricing
NM_176923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151462 predicted 1278
2 SASI_Hs01_00151463 predicted 2653
3 SASI_Hs01_00151464 predicted 2091
4 SASI_Hs02_00358152 predicted 1086
5 SASI_Hs01_00151466 predicted 3056
6 SASI_Hs01_00151467 predicted 2739
7 SASI_Hs01_00151468 predicted 2414
8 SASI_Hs02_00358153 predicted 2172
9 SASI_Hs01_00151469 predicted 1106
10 SASI_Hs01_00151470 predicted 2202
11 SASI_Hs01_00151465 predicted 832
12 SASI_Hs01_00151471 predicted 2778
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00413276 predicted 479
2 SASI_Rn02_00413277 predicted 744
3 SASI_Rn02_00413278 predicted 388
4 SASI_Rn01_00158870 predicted 296
5 SASI_Rn02_00413279 predicted 492
6 SASI_Rn01_00158874 predicted 327
7 SASI_Rn01_00158875 predicted 641
8 SASI_Rn01_00158876 predicted 470
9 SASI_Rn01_00158877 predicted 616
10 SASI_Rn02_00413280 predicted 1139
11 SASI_Rn01_00158868 predicted 600
12 SASI_Rn01_00158869 predicted 1214
13 SASI_Rn01_00158871 predicted 1677
14 SASI_Rn01_00158872 predicted 2402
15 SASI_Rn01_00158873 predicted 2017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107046 predicted 239
2 SASI_Mm01_00107047 predicted 204
3 SASI_Mm02_00346811 predicted 1860
4 SASI_Mm01_00107048 predicted 2738
5 SASI_Mm01_00107049 predicted 827
6 SASI_Mm01_00107050 predicted 2689
7 SASI_Mm01_00107051 predicted 1853
8 SASI_Mm01_00107052 predicted 1741
9 SASI_Mm01_00107054 predicted 2722
10 SASI_Mm01_00107055 predicted 2277
11 SASI_Mm01_00107053 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030581
VALIDATED
WDR59 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 59
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-337s21c1
Sequence:CCGGGCTTCGAGTAACCAACGAGTACTCGAGTACTCGTTGGTTACTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-605s21c1
Sequence:CCGGATGACGGCGATGTGCGGATATCTCGAGATATCCGCACATCGCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-1069s21c1
Sequence:CCGGCTTTGTGCAAATGACATATTACTCGAGTAATATGTCATTTGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030581.3-1739s21c1
Sequence:CCGGGAGCAGGTTACCTGGTATATTCTCGAGAATATACCAGGTAACCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-3028s21c1
Sequence:CCGGACCTACAGAAGTTGGGTATTGCTCGAGCAATACCCAACTTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030581.3-2737s1c1
Sequence:CCGGCGAGCTGAAGTGTTGAAGTTTCTCGAGAAACTTCAACACTTCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030581.3-3474s1c1
Sequence:CCGGGCTTTAGAAGCTGGTACATTTCTCGAGAAATGTACCAGCTTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030581.3-771s1c1
Sequence:CCGGGCCTCGGAAATACCTCAATATCTCGAGATATTGAGGTATTTCCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-1308s1c1
Sequence:CCGGCCGGAATGTCAATGTGGAGATCTCGAGATCTCCACATTGACATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-337s1c1
Sequence:CCGGGCTTCGAGTAACCAACGAGTACTCGAGTACTCGTTGGTTACTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030581.3-3350s1c1
Sequence:CCGGCCCTGTAAGGTGTTAGCCTTACTCGAGTAAGGCTAACACCTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-1965s1c1
Sequence:CCGGGCGGAAATCAAGACGATGGAACTCGAGTTCCATCGTCTTGATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030581
VALIDATED
WDR59 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 59
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-337s21c1
Sequence:CCGGGCTTCGAGTAACCAACGAGTACTCGAGTACTCGTTGGTTACTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-605s21c1
Sequence:CCGGATGACGGCGATGTGCGGATATCTCGAGATATCCGCACATCGCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-1069s21c1
Sequence:CCGGCTTTGTGCAAATGACATATTACTCGAGTAATATGTCATTTGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030581.3-1739s21c1
Sequence:CCGGGAGCAGGTTACCTGGTATATTCTCGAGAATATACCAGGTAACCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-3028s21c1
Sequence:CCGGACCTACAGAAGTTGGGTATTGCTCGAGCAATACCCAACTTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030581.3-2737s1c1
Sequence:CCGGCGAGCTGAAGTGTTGAAGTTTCTCGAGAAACTTCAACACTTCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030581.3-3474s1c1
Sequence:CCGGGCTTTAGAAGCTGGTACATTTCTCGAGAAATGTACCAGCTTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030581.3-771s1c1
Sequence:CCGGGCCTCGGAAATACCTCAATATCTCGAGATATTGAGGTATTTCCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-1308s1c1
Sequence:CCGGCCGGAATGTCAATGTGGAGATCTCGAGATCTCCACATTGACATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-337s1c1
Sequence:CCGGGCTTCGAGTAACCAACGAGTACTCGAGTACTCGTTGGTTACTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030581.3-3350s1c1
Sequence:CCGGCCCTGTAAGGTGTTAGCCTTACTCGAGTAAGGCTAACACCTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-1965s1c1
Sequence:CCGGGCGGAAATCAAGACGATGGAACTCGAGTTCCATCGTCTTGATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030581
VALIDATED
WDR59 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 59
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-337s21c1
Sequence:CCGGGCTTCGAGTAACCAACGAGTACTCGAGTACTCGTTGGTTACTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-605s21c1
Sequence:CCGGATGACGGCGATGTGCGGATATCTCGAGATATCCGCACATCGCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-1069s21c1
Sequence:CCGGCTTTGTGCAAATGACATATTACTCGAGTAATATGTCATTTGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030581.3-1739s21c1
Sequence:CCGGGAGCAGGTTACCTGGTATATTCTCGAGAATATACCAGGTAACCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_030581.3-3028s21c1
Sequence:CCGGACCTACAGAAGTTGGGTATTGCTCGAGCAATACCCAACTTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030581.3-2737s1c1
Sequence:CCGGCGAGCTGAAGTGTTGAAGTTTCTCGAGAAACTTCAACACTTCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030581.3-3474s1c1
Sequence:CCGGGCTTTAGAAGCTGGTACATTTCTCGAGAAATGTACCAGCTTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030581.3-771s1c1
Sequence:CCGGGCCTCGGAAATACCTCAATATCTCGAGATATTGAGGTATTTCCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-1308s1c1
Sequence:CCGGCCGGAATGTCAATGTGGAGATCTCGAGATCTCCACATTGACATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-337s1c1
Sequence:CCGGGCTTCGAGTAACCAACGAGTACTCGAGTACTCGTTGGTTACTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030581.3-3350s1c1
Sequence:CCGGCCCTGTAAGGTGTTAGCCTTACTCGAGTAAGGCTAACACCTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030581.3-1965s1c1
Sequence:CCGGGCGGAAATCAAGACGATGGAACTCGAGTTCCATCGTCTTGATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176923
WDR59 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 59
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176923.3-2575s1c1
Sequence:CCGGGAACGAGACCAGCATGATAAACTCGAGTTTATCATGCTGGTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176923.2-2732s1c1
Sequence:CCGGCCTCACAAAGGGATCGAGTTTCTCGAGAAACTCGATCCCTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176923.2-897s1c1
Sequence:CCGGCCAAGGACTATCAACTGGTTACTCGAGTAACCAGTTGATAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176923.2-3336s1c1
Sequence:CCGGCCATCCAGATGCCAGTACAAACTCGAGTTTGTACTGGCATCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176923.2-3088s1c1
Sequence:CCGGCGTGATTTAGGATGGAGAGTACTCGAGTACTCTCCATCCTAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176923.2-2484s1c1
Sequence:CCGGGAGAGACAGAACACATATCTTCTCGAGAAGATATGTGTTCTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176923
WDR59 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 59
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176923.3-2575s1c1
Sequence:CCGGGAACGAGACCAGCATGATAAACTCGAGTTTATCATGCTGGTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176923.2-2732s1c1
Sequence:CCGGCCTCACAAAGGGATCGAGTTTCTCGAGAAACTCGATCCCTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176923.2-897s1c1
Sequence:CCGGCCAAGGACTATCAACTGGTTACTCGAGTAACCAGTTGATAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176923.2-3336s1c1
Sequence:CCGGCCATCCAGATGCCAGTACAAACTCGAGTTTGTACTGGCATCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176923.2-3088s1c1
Sequence:CCGGCGTGATTTAGGATGGAGAGTACTCGAGTACTCTCCATCCTAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176923.2-2484s1c1
Sequence:CCGGGAGAGACAGAACACATATCTTCTCGAGAAGATATGTGTTCTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176923
WDR59 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 59
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176923.3-2575s1c1
Sequence:CCGGGAACGAGACCAGCATGATAAACTCGAGTTTATCATGCTGGTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176923.2-2732s1c1
Sequence:CCGGCCTCACAAAGGGATCGAGTTTCTCGAGAAACTCGATCCCTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176923.2-897s1c1
Sequence:CCGGCCAAGGACTATCAACTGGTTACTCGAGTAACCAGTTGATAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176923.2-3336s1c1
Sequence:CCGGCCATCCAGATGCCAGTACAAACTCGAGTTTGTACTGGCATCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176923.2-3088s1c1
Sequence:CCGGCGTGATTTAGGATGGAGAGTACTCGAGTACTCTCCATCCTAAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176923.2-2484s1c1
Sequence:CCGGGAGAGACAGAACACATATCTTCTCGAGAAGATATGTGTTCTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks