EMAIL THIS PAGE TO A FRIEND

WDR5

WD repeat domain 5

Synonyms: BIG-3 SWD3
UniProtKB ID: P61964, Q91VA5, Q9NWX7, Q9UGP9
Gene ID:
Human(11091) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 7 WD repeats. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(140858) WD repeat domain 5
Rat(362093) WD repeat domain 5
Zebrafish(406372) WD repeat domain 5
chicken(417144) WD repeat domain 5
domestic cat(101082447) WD repeat domain 5
Horse(100069126) WD repeat domain 5
dog(608113) WD repeat domain 5
cow(100125836) WD repeat domain 5
domestic guinea pig(100719056) WD repeat domain 5
naked mole-rat(101723351) WD repeat domain 5
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052821 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017588 Rosetta Predictions human pricing
NM_052821 Rosetta Predictions human pricing
NM_001039034 Rosetta Predictions rat pricing
NM_080848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046875 predicted 443
2 SASI_Hs01_00046876 predicted 458
3 SASI_Hs01_00046877 predicted 1370
4 SASI_Hs01_00046878 predicted 1069
5 SASI_Hs01_00046879 predicted 458
6 SASI_Hs01_00046880 predicted 454
7 SASI_Hs01_00046881 predicted 1039
8 SASI_Hs01_00046882 predicted 1053
9 SASI_Hs01_00046883 predicted 608
10 SASI_Hs01_00046884 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092998 predicted 354
2 SASI_Hs01_00092999 predicted 372
3 SASI_Hs01_00093000 predicted 1285
4 SASI_Hs01_00093001 predicted 980
5 SASI_Hs01_00093002 predicted 374
6 SASI_Hs01_00093003 predicted 375
7 SASI_Hs01_00093004 predicted 959
8 SASI_Hs01_00093005 predicted 970
9 SASI_Hs01_00093006 predicted 522
10 SASI_Hs01_00093007 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204788 predicted 1194
2 SASI_Rn01_00067661 predicted 734
3 SASI_Rn01_00067662 predicted 536
4 SASI_Rn01_00067663 predicted 578
5 SASI_Rn01_00067664 predicted 1131
6 SASI_Rn01_00067665 predicted 456
7 SASI_Rn01_00067666 predicted 1239
8 SASI_Rn01_00067667 predicted 1259
9 SASI_Rn01_00067668 predicted 648
10 SASI_Rn01_00067669 predicted 1071
11 SASI_Rn01_00067670 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123032 predicted 397
2 SASI_Mm01_00123033 predicted 845
3 SASI_Mm01_00123034 predicted 1121
4 SASI_Mm01_00123035 predicted 1098
5 SASI_Mm01_00123036 predicted 1212
6 SASI_Mm01_00123037 predicted 509
7 SASI_Mm01_00123038 predicted 1046
8 SASI_Mm01_00123039 predicted 971
9 SASI_Mm01_00123041 predicted 398
10 SASI_Mm02_00338221 predicted 384
11 SASI_Mm01_00123040 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080848
VALIDATED
WDR5 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-2507s1c1
Sequence:CCGGCGTGCATAATAAGAATCCAAACTCGAGTTTGGATTCTTATTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-318s1c1
Sequence:CCGGGCCAAACTATGCCCTGAAGTTCTCGAGAACTTCAGGGCATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080848.1-876s1c1
Sequence:CCGGCTTCGTGAAGTTCTCTCCAAACTCGAGTTTGGAGAGAACTTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-748s1c1
Sequence:CCGGGCCGTTCATTTCAACCGTGATCTCGAGATCACGGTTGAAATGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-1177s1c1
Sequence:CCGGGCAGCGTTAGAGAACGACAAACTCGAGTTTGTCGTTCTCTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-313s21c1
Sequence:CCGGGCCAAACTATGCCCTGAAGTTCTCGAGAACTTCAGGGCATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-1172s21c1
Sequence:CCGGGCAGCGTTAGAGAACGACAAACTCGAGTTTGTCGTTCTCTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-743s21c1
Sequence:CCGGGCCGTTCATTTCAACCGTGATCTCGAGATCACGGTTGAAATGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-399s21c1
Sequence:CCGGCAAGTTCATCTGCTGATAAACCTCGAGGTTTATCAGCAGATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080848.2-1370s21c1
Sequence:CCGGTTGATAGCCACTGTGATATTTCTCGAGAAATATCACAGTGGCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080848
VALIDATED
WDR5 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-2507s1c1
Sequence:CCGGCGTGCATAATAAGAATCCAAACTCGAGTTTGGATTCTTATTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-318s1c1
Sequence:CCGGGCCAAACTATGCCCTGAAGTTCTCGAGAACTTCAGGGCATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080848.1-876s1c1
Sequence:CCGGCTTCGTGAAGTTCTCTCCAAACTCGAGTTTGGAGAGAACTTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-748s1c1
Sequence:CCGGGCCGTTCATTTCAACCGTGATCTCGAGATCACGGTTGAAATGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-1177s1c1
Sequence:CCGGGCAGCGTTAGAGAACGACAAACTCGAGTTTGTCGTTCTCTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-313s21c1
Sequence:CCGGGCCAAACTATGCCCTGAAGTTCTCGAGAACTTCAGGGCATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-1172s21c1
Sequence:CCGGGCAGCGTTAGAGAACGACAAACTCGAGTTTGTCGTTCTCTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-743s21c1
Sequence:CCGGGCCGTTCATTTCAACCGTGATCTCGAGATCACGGTTGAAATGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-399s21c1
Sequence:CCGGCAAGTTCATCTGCTGATAAACCTCGAGGTTTATCAGCAGATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080848.2-1370s21c1
Sequence:CCGGTTGATAGCCACTGTGATATTTCTCGAGAAATATCACAGTGGCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080848
VALIDATED
WDR5 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-2507s1c1
Sequence:CCGGCGTGCATAATAAGAATCCAAACTCGAGTTTGGATTCTTATTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-318s1c1
Sequence:CCGGGCCAAACTATGCCCTGAAGTTCTCGAGAACTTCAGGGCATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080848.1-876s1c1
Sequence:CCGGCTTCGTGAAGTTCTCTCCAAACTCGAGTTTGGAGAGAACTTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-748s1c1
Sequence:CCGGGCCGTTCATTTCAACCGTGATCTCGAGATCACGGTTGAAATGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080848.1-1177s1c1
Sequence:CCGGGCAGCGTTAGAGAACGACAAACTCGAGTTTGTCGTTCTCTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-313s21c1
Sequence:CCGGGCCAAACTATGCCCTGAAGTTCTCGAGAACTTCAGGGCATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-1172s21c1
Sequence:CCGGGCAGCGTTAGAGAACGACAAACTCGAGTTTGTCGTTCTCTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-743s21c1
Sequence:CCGGGCCGTTCATTTCAACCGTGATCTCGAGATCACGGTTGAAATGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080848.2-399s21c1
Sequence:CCGGCAAGTTCATCTGCTGATAAACCTCGAGGTTTATCAGCAGATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080848.2-1370s21c1
Sequence:CCGGTTGATAGCCACTGTGATATTTCTCGAGAAATATCACAGTGGCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052821
VALIDATED
WDR5 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_052821.3-1213s1c1
Sequence:CCGGGCCTCCTCTCTGAAGATGATTCTCGAGAATCATCTTCAGAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052821.3-916s1c1
Sequence:CCGGGCTCAGAGGATAACCTTGTTTCTCGAGAAACAAGGTTATCCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052821.3-369s1c1
Sequence:CCGGTGGTCGTCAGATTCTAACCTTCTCGAGAAGGTTAGAATCTGACGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052821.3-508s1c1
Sequence:CCGGCCAACCTTATTGTCTCAGGATCTCGAGATCCTGAGACAATAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1584s21c1
Sequence:CCGGAGTAGCTGTTCCTAGTGTATTCTCGAGAATACACTAGGAACAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1391s21c1
Sequence:CCGGCAATTTAACATGCGTTGTGTTCTCGAGAACACAACGCATGTTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1527s21c1
Sequence:CCGGCCCATTCTCTGCTGCGTAGATCTCGAGATCTACGCAGCAGAGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052821.3-304s21c1
Sequence:CCGGGCGCGTATGATGGGAAATTTGCTCGAGCAAATTTCCCATCATACGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052821
VALIDATED
WDR5 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_052821.3-1213s1c1
Sequence:CCGGGCCTCCTCTCTGAAGATGATTCTCGAGAATCATCTTCAGAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052821.3-916s1c1
Sequence:CCGGGCTCAGAGGATAACCTTGTTTCTCGAGAAACAAGGTTATCCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052821.3-369s1c1
Sequence:CCGGTGGTCGTCAGATTCTAACCTTCTCGAGAAGGTTAGAATCTGACGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052821.3-508s1c1
Sequence:CCGGCCAACCTTATTGTCTCAGGATCTCGAGATCCTGAGACAATAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1584s21c1
Sequence:CCGGAGTAGCTGTTCCTAGTGTATTCTCGAGAATACACTAGGAACAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1391s21c1
Sequence:CCGGCAATTTAACATGCGTTGTGTTCTCGAGAACACAACGCATGTTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1527s21c1
Sequence:CCGGCCCATTCTCTGCTGCGTAGATCTCGAGATCTACGCAGCAGAGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052821.3-304s21c1
Sequence:CCGGGCGCGTATGATGGGAAATTTGCTCGAGCAAATTTCCCATCATACGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052821
VALIDATED
WDR5 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_052821.3-1213s1c1
Sequence:CCGGGCCTCCTCTCTGAAGATGATTCTCGAGAATCATCTTCAGAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052821.3-916s1c1
Sequence:CCGGGCTCAGAGGATAACCTTGTTTCTCGAGAAACAAGGTTATCCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052821.3-369s1c1
Sequence:CCGGTGGTCGTCAGATTCTAACCTTCTCGAGAAGGTTAGAATCTGACGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052821.3-508s1c1
Sequence:CCGGCCAACCTTATTGTCTCAGGATCTCGAGATCCTGAGACAATAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1584s21c1
Sequence:CCGGAGTAGCTGTTCCTAGTGTATTCTCGAGAATACACTAGGAACAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1391s21c1
Sequence:CCGGCAATTTAACATGCGTTGTGTTCTCGAGAACACAACGCATGTTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052821.3-1527s21c1
Sequence:CCGGCCCATTCTCTGCTGCGTAGATCTCGAGATCTACGCAGCAGAGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052821.3-304s21c1
Sequence:CCGGGCGCGTATGATGGGAAATTTGCTCGAGCAAATTTCCCATCATACGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks