EMAIL THIS PAGE TO A FRIEND

WDR5B

WD repeat domain 5B

UniProtKB ID: Q86VZ2, B2RCM9, Q9NUL4
Gene ID:
Human(54554) Summary: This intronless gene encodes a protein containing several WD40 repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, including a trp-asp at the C-terminal end. The encoded protein may mediate protein-protein interactions. [provided by RefSeq, Jul 2008]
Mouse(69544) WD repeat domain 5B
Rat(303907) WD repeat domain 5B
domestic cat(101086592) WD repeat domain 5B
dog(100685660) WD repeat domain 5B
cow(100138335) WD repeat domain 5B
sheep(101113552) WD repeat domain 5B
domestic guinea pig(100718368) WD repeat domain 5B
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019069 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019069 Rosetta Predictions human pricing
NM_001024766 Rosetta Predictions rat pricing
NM_027113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112544 predicted 1356
2 SASI_Hs01_00112545 predicted 732
3 SASI_Hs01_00112547 predicted 988
4 SASI_Hs01_00112548 predicted 1245
5 SASI_Hs01_00112549 predicted 634
6 SASI_Hs01_00112551 predicted 1184
7 SASI_Hs01_00112553 predicted 761
8 SASI_Hs02_00352658 predicted 520
9 SASI_Hs02_00352659 predicted 1162
10 SASI_Hs02_00352660 predicted 921
11 SASI_Hs01_00112546 predicted 1127
12 SASI_Hs01_00112550 predicted 1054
13 SASI_Hs01_00112552 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080249 predicted 522
2 SASI_Rn01_00080250 predicted 1321
3 SASI_Rn01_00080251 predicted 490
4 SASI_Rn01_00080252 predicted 475
5 SASI_Rn01_00080253 predicted 598
6 SASI_Rn01_00080254 predicted 1145
7 SASI_Rn01_00080255 predicted 513
8 SASI_Rn01_00080256 predicted 1125
9 SASI_Rn01_00080258 predicted 912
10 SASI_Rn02_00202647 predicted 1068
11 SASI_Rn01_00080257 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119823 predicted 400
2 SASI_Mm01_00119824 predicted 1014
3 SASI_Mm01_00119825 predicted 636
4 SASI_Mm01_00119826 predicted 1104
5 SASI_Mm01_00119828 predicted 553
6 SASI_Mm01_00119829 predicted 436
7 SASI_Mm01_00119830 predicted 1052
8 SASI_Mm01_00119832 predicted 459
9 SASI_Mm02_00331556 predicted 588
10 SASI_Mm02_00331557 predicted 1396
11 SASI_Mm01_00119827 predicted 1369
12 SASI_Mm01_00119831 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027113
WDR5B MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 5B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-999s1c1
Sequence:CCGGGCAACTTTGGACAATACTCTTCTCGAGAAGAGTATTGTCCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-402s1c1
Sequence:CCGGCCCAACTATGCTCTCAGACTTCTCGAGAAGTCTGAGAGCATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-442s21c1
Sequence:CCGGCGGCCATATCATCAGTTAAATCTCGAGATTTAACTGATGATATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027113.2-1372s1c1
Sequence:CCGGGGATTCTGGCAAAGCTTAAACCTCGAGGTTTAAGCTTTGCCAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-1063s1c1
Sequence:CCGGCTGGTCATAAGAATGAGAAATCTCGAGATTTCTCATTCTTATGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-494s21c1
Sequence:CCGGTGCAGCTGATGCACTAATTATCTCGAGATAATTAGTGCATCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027113.2-1618s21c1
Sequence:CCGGCTCTGGTTTGGGAGGTCATTACTCGAGTAATGACCTCCCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-596s21c1
Sequence:CCGGAGATTCTAGTCGTCTAGTTTCCTCGAGGAAACTAGACGACTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-391s21c1
Sequence:CCGGAGCCGCAGAAACCCAACTATGCTCGAGCATAGTTGGGTTTCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027113
WDR5B MISSION shRNA shRNA Plasmid DNA
WD repeat domain 5B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-999s1c1
Sequence:CCGGGCAACTTTGGACAATACTCTTCTCGAGAAGAGTATTGTCCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-402s1c1
Sequence:CCGGCCCAACTATGCTCTCAGACTTCTCGAGAAGTCTGAGAGCATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-442s21c1
Sequence:CCGGCGGCCATATCATCAGTTAAATCTCGAGATTTAACTGATGATATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027113.2-1372s1c1
Sequence:CCGGGGATTCTGGCAAAGCTTAAACCTCGAGGTTTAAGCTTTGCCAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-1063s1c1
Sequence:CCGGCTGGTCATAAGAATGAGAAATCTCGAGATTTCTCATTCTTATGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-494s21c1
Sequence:CCGGTGCAGCTGATGCACTAATTATCTCGAGATAATTAGTGCATCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027113.2-1618s21c1
Sequence:CCGGCTCTGGTTTGGGAGGTCATTACTCGAGTAATGACCTCCCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-596s21c1
Sequence:CCGGAGATTCTAGTCGTCTAGTTTCCTCGAGGAAACTAGACGACTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-391s21c1
Sequence:CCGGAGCCGCAGAAACCCAACTATGCTCGAGCATAGTTGGGTTTCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027113
WDR5B MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 5B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-999s1c1
Sequence:CCGGGCAACTTTGGACAATACTCTTCTCGAGAAGAGTATTGTCCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-402s1c1
Sequence:CCGGCCCAACTATGCTCTCAGACTTCTCGAGAAGTCTGAGAGCATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-442s21c1
Sequence:CCGGCGGCCATATCATCAGTTAAATCTCGAGATTTAACTGATGATATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027113.2-1372s1c1
Sequence:CCGGGGATTCTGGCAAAGCTTAAACCTCGAGGTTTAAGCTTTGCCAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027113.2-1063s1c1
Sequence:CCGGCTGGTCATAAGAATGAGAAATCTCGAGATTTCTCATTCTTATGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-494s21c1
Sequence:CCGGTGCAGCTGATGCACTAATTATCTCGAGATAATTAGTGCATCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027113.2-1618s21c1
Sequence:CCGGCTCTGGTTTGGGAGGTCATTACTCGAGTAATGACCTCCCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-596s21c1
Sequence:CCGGAGATTCTAGTCGTCTAGTTTCCTCGAGGAAACTAGACGACTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027113.2-391s21c1
Sequence:CCGGAGCCGCAGAAACCCAACTATGCTCGAGCATAGTTGGGTTTCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019069
WDR5B MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 5B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019069.3-2212s1c1
Sequence:CCGGGCTGCGATAAACAGCACTATTCTCGAGAATAGTGCTGTTTATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1375s1c1
Sequence:CCGGGTGCAGAAATTACAAGGCCATCTCGAGATGGCCTTGTAATTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1010s1c1
Sequence:CCGGACCCAGTTTCTGCTGTTCATTCTCGAGAATGAACAGCAGAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1189s1c1
Sequence:CCGGGCAACTTTGGACAACACTCTTCTCGAGAAGAGTGTTGTCCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-921s1c1
Sequence:CCGGCCTTATAATCTCGGGATCTTTCTCGAGAAAGATCCCGAGATTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019069.3-1763s21c1
Sequence:CCGGGTGAAATCTGGGCTTAGTATACTCGAGTATACTAAGCCCAGATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019069.3-644s21c1
Sequence:CCGGCAGTTAAGTTTAGTCCTAATGCTCGAGCATTAGGACTAAACTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019069
WDR5B MISSION shRNA shRNA Plasmid DNA
WD repeat domain 5B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019069.3-2212s1c1
Sequence:CCGGGCTGCGATAAACAGCACTATTCTCGAGAATAGTGCTGTTTATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1375s1c1
Sequence:CCGGGTGCAGAAATTACAAGGCCATCTCGAGATGGCCTTGTAATTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1010s1c1
Sequence:CCGGACCCAGTTTCTGCTGTTCATTCTCGAGAATGAACAGCAGAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1189s1c1
Sequence:CCGGGCAACTTTGGACAACACTCTTCTCGAGAAGAGTGTTGTCCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-921s1c1
Sequence:CCGGCCTTATAATCTCGGGATCTTTCTCGAGAAAGATCCCGAGATTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019069.3-1763s21c1
Sequence:CCGGGTGAAATCTGGGCTTAGTATACTCGAGTATACTAAGCCCAGATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019069.3-644s21c1
Sequence:CCGGCAGTTAAGTTTAGTCCTAATGCTCGAGCATTAGGACTAAACTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019069
WDR5B MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 5B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019069.3-2212s1c1
Sequence:CCGGGCTGCGATAAACAGCACTATTCTCGAGAATAGTGCTGTTTATCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1375s1c1
Sequence:CCGGGTGCAGAAATTACAAGGCCATCTCGAGATGGCCTTGTAATTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1010s1c1
Sequence:CCGGACCCAGTTTCTGCTGTTCATTCTCGAGAATGAACAGCAGAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-1189s1c1
Sequence:CCGGGCAACTTTGGACAACACTCTTCTCGAGAAGAGTGTTGTCCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019069.3-921s1c1
Sequence:CCGGCCTTATAATCTCGGGATCTTTCTCGAGAAAGATCCCGAGATTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019069.3-1763s21c1
Sequence:CCGGGTGAAATCTGGGCTTAGTATACTCGAGTATACTAAGCCCAGATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019069.3-644s21c1
Sequence:CCGGCAGTTAAGTTTAGTCCTAATGCTCGAGCATTAGGACTAAACTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks