EMAIL THIS PAGE TO A FRIEND

WDR60

WD repeat domain 60

UniProtKB ID: Q8WVS4, Q9NW58
Gene ID:
Mouse(217935) WD repeat domain 60
Rat(314523) WD repeat domain 60
chicken(420452) WD repeat domain 60
Horse(100057672) WD repeat domain 60
domestic cat(101090178) WD repeat domain 60
dog(482827) WD repeat domain 60
cow(767895) WD repeat domain 60
sheep(101119208) WD repeat domain 60
naked mole-rat(101713292) WD repeat domain 60
Domestic Rabbit(100351166) WD repeat domain 60
domestic guinea pig(100725115) WD repeat domain 60
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018051 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003941 MISSION® esiRNA esiRNA targeting human WDR60 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018051 Rosetta Predictions human pricing
XM_001061189 Rosetta Predictions rat pricing
XM_234706 Rosetta Predictions rat pricing
NM_146039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065540 predicted 2910
2 SASI_Hs01_00065541 predicted 2868
3 SASI_Hs01_00065542 predicted 3380
4 SASI_Hs01_00065543 predicted 2878
5 SASI_Hs01_00065544 predicted 2762
6 SASI_Hs01_00065545 predicted 2335
7 SASI_Hs01_00065546 predicted 2414
8 SASI_Hs01_00065547 predicted 2798
9 SASI_Hs01_00065549 predicted 2612
10 SASI_Hs02_00351185 predicted 965
11 SASI_Hs01_00065548 predicted 2821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299085 predicted 2482
2 SASI_Rn02_00299086 predicted 2867
3 SASI_Rn02_00299087 predicted 1483
4 SASI_Rn02_00299088 predicted 1511
5 SASI_Rn02_00299089 predicted 2599
6 SASI_Rn02_00299090 predicted 2745
7 SASI_Rn02_00299091 predicted 2331
8 SASI_Rn02_00299092 predicted 3053
9 SASI_Rn02_00299093 predicted 2775
10 SASI_Rn02_00299094 predicted 2884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388617 predicted 2483
2 SASI_Rn02_00388618 predicted 2863
3 SASI_Rn02_00388619 predicted 1491
4 SASI_Rn02_00388620 predicted 1511
5 SASI_Rn02_00388621 predicted 2606
6 SASI_Rn02_00388622 predicted 2749
7 SASI_Rn02_00388623 predicted 2333
8 SASI_Rn02_00388624 predicted 3058
9 SASI_Rn02_00388625 predicted 2779
10 SASI_Rn02_00388626 predicted 2884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341634 predicted 2526
2 SASI_Mm02_00341635 predicted 1038
3 SASI_Mm02_00341636 predicted 1125
4 SASI_Mm02_00341637 predicted 2505
5 SASI_Mm02_00341638 predicted 2437
6 SASI_Mm02_00341639 predicted 2918
7 SASI_Mm02_00341640 predicted 2882
8 SASI_Mm02_00341641 predicted 2149
9 SASI_Mm02_00341642 predicted 951
10 SASI_Mm02_00341643 predicted 2631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146039
VALIDATED
WDR60 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 60
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-1239s1c1
Sequence:CCGGGTTGGCGAGTTATCTTTGAAACTCGAGTTTCAAAGATAACTCGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-679s1c1
Sequence:CCGGGAGAAAGAAGATACCGAGAAACTCGAGTTTCTCGGTATCTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146039.2-2192s1c1
Sequence:CCGGGCAGGCTTTCAAATGATTAAACTCGAGTTTAATCATTTGAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-419s1c1
Sequence:CCGGCCGTGAGAAAGACAAGCTAAACTCGAGTTTAGCTTGTCTTTCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146039
VALIDATED
WDR60 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 60
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-1239s1c1
Sequence:CCGGGTTGGCGAGTTATCTTTGAAACTCGAGTTTCAAAGATAACTCGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-679s1c1
Sequence:CCGGGAGAAAGAAGATACCGAGAAACTCGAGTTTCTCGGTATCTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146039.2-2192s1c1
Sequence:CCGGGCAGGCTTTCAAATGATTAAACTCGAGTTTAATCATTTGAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-419s1c1
Sequence:CCGGCCGTGAGAAAGACAAGCTAAACTCGAGTTTAGCTTGTCTTTCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146039
VALIDATED
WDR60 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 60
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-1239s1c1
Sequence:CCGGGTTGGCGAGTTATCTTTGAAACTCGAGTTTCAAAGATAACTCGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-679s1c1
Sequence:CCGGGAGAAAGAAGATACCGAGAAACTCGAGTTTCTCGGTATCTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146039.2-2192s1c1
Sequence:CCGGGCAGGCTTTCAAATGATTAAACTCGAGTTTAATCATTTGAAAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146039.2-419s1c1
Sequence:CCGGCCGTGAGAAAGACAAGCTAAACTCGAGTTTAGCTTGTCTTTCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018051
VALIDATED
WDR60 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 60
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138760    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018051.2-3380s1c1
Sequence:CCGGGCGTTTCTGTAATGACCCAGACTCGAGTCTGGGTCATTACAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018051.2-2794s1c1
Sequence:CCGGGCACAGACATGGGTCTCATAACTCGAGTTATGAGACCCATGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-3080s1c1
Sequence:CCGGCGACACATCCAACATCTACATCTCGAGATGTAGATGTTGGATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-1749s1c1
Sequence:CCGGGCATATGTTCAGTGTAACGAACTCGAGTTCGTTACACTGAACATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018051.2-2621s1c1
Sequence:CCGGCGCAGGTTCAATAAGTGATTTCTCGAGAAATCACTTATTGAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-2815s1c1
Sequence:CCGGGCCATGGCACAAGACAAGATTCTCGAGAATCTTGTCTTGTGCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018051
VALIDATED
WDR60 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 60
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138760    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018051.2-3380s1c1
Sequence:CCGGGCGTTTCTGTAATGACCCAGACTCGAGTCTGGGTCATTACAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018051.2-2794s1c1
Sequence:CCGGGCACAGACATGGGTCTCATAACTCGAGTTATGAGACCCATGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-3080s1c1
Sequence:CCGGCGACACATCCAACATCTACATCTCGAGATGTAGATGTTGGATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-1749s1c1
Sequence:CCGGGCATATGTTCAGTGTAACGAACTCGAGTTCGTTACACTGAACATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018051.2-2621s1c1
Sequence:CCGGCGCAGGTTCAATAAGTGATTTCTCGAGAAATCACTTATTGAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-2815s1c1
Sequence:CCGGGCCATGGCACAAGACAAGATTCTCGAGAATCTTGTCTTGTGCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018051
VALIDATED
WDR60 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 60
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138760    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018051.2-3380s1c1
Sequence:CCGGGCGTTTCTGTAATGACCCAGACTCGAGTCTGGGTCATTACAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018051.2-2794s1c1
Sequence:CCGGGCACAGACATGGGTCTCATAACTCGAGTTATGAGACCCATGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-3080s1c1
Sequence:CCGGCGACACATCCAACATCTACATCTCGAGATGTAGATGTTGGATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-1749s1c1
Sequence:CCGGGCATATGTTCAGTGTAACGAACTCGAGTTCGTTACACTGAACATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018051.2-2621s1c1
Sequence:CCGGCGCAGGTTCAATAAGTGATTTCTCGAGAAATCACTTATTGAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018051.2-2815s1c1
Sequence:CCGGGCCATGGCACAAGACAAGATTCTCGAGAATCTTGTCTTGTGCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks