EMAIL THIS PAGE TO A FRIEND

WDR61

WD repeat domain 61

Synonyms: REC14 SKI8
UniProtKB ID: Q9GZS3, D3DW84, Q6IA22, Q7Z4X4
Gene ID:
Human(80349) Summary: WDR61 is a subunit of the human PAF and SKI complexes, which function in transcriptional regulation and are involved in events downstream of RNA synthesis, such as RNA surveillance (Zhu et al., 2005 [PubMed 16024656]
Mouse(66317) WD repeat domain 61
Rat(363064) WD repeat domain 61
domestic guinea pig(100720399) WD repeat domain 61
naked mole-rat(101703745) WD repeat domain 61
cow(513208) WD repeat domain 61
sheep(101121805) WD repeat domain 61
Zebrafish(393827) WD repeat domain 61
domestic cat(101085467) WD repeat domain 61
dog(479068) WD repeat domain 61
chicken(415359) WD repeat domain 61
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025234 Rosetta Predictions human pricing
NM_001025743 Rosetta Predictions rat pricing
NM_001025375 Rosetta Predictions mouse pricing
NM_001025376 Rosetta Predictions mouse pricing
NM_023191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155940 predicted 326
2 SASI_Hs01_00155941 predicted 570
3 SASI_Hs01_00155942 predicted 220
4 SASI_Hs01_00155943 predicted 715
5 SASI_Hs01_00155944 predicted 804
6 SASI_Hs01_00155945 predicted 530
7 SASI_Hs01_00155946 predicted 703
8 SASI_Hs01_00155947 predicted 957
9 SASI_Hs01_00155948 predicted 440
10 SASI_Hs01_00155949 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053964 predicted 673
2 SASI_Rn01_00053965 predicted 743
3 SASI_Rn01_00053966 predicted 737
4 SASI_Rn01_00053967 predicted 605
5 SASI_Rn01_00053968 predicted 896
6 SASI_Rn01_00053969 predicted 559
7 SASI_Rn01_00053970 predicted 385
8 SASI_Rn01_00053971 predicted 846
9 SASI_Rn01_00053972 predicted 898
10 SASI_Rn02_00203385 predicted 250
11 SASI_Rn01_00053973 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130492 predicted 628
2 SASI_Mm02_00287849 predicted 782
3 SASI_Mm01_00130493 predicted 800
4 SASI_Mm01_00130494 predicted 459
5 SASI_Mm01_00130495 predicted 927
6 SASI_Mm01_00130497 predicted 793
7 SASI_Mm02_00287850 predicted 665
8 SASI_Mm01_00130498 predicted 1035
9 SASI_Mm01_00130499 predicted 450
10 SASI_Mm01_00130500 predicted 585
11 SASI_Mm01_00130496 predicted 408
12 SASI_Mm01_00130501 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081681 predicted 525
2 SASI_Mm01_00081682 predicted 709
3 SASI_Mm01_00081683 predicted 566
4 SASI_Mm01_00081684 predicted 360
5 SASI_Mm01_00081685 predicted 701
6 SASI_Mm01_00081686 predicted 751
7 SASI_Mm01_00081687 predicted 945
8 SASI_Mm01_00081688 predicted 644
9 SASI_Mm01_00081689 predicted 381
10 SASI_Mm01_00081690 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146241 predicted 550
2 SASI_Mm02_00326920 predicted 714
3 SASI_Mm01_00146242 predicted 726
4 SASI_Mm01_00146243 predicted 387
5 SASI_Mm01_00146244 predicted 852
6 SASI_Mm01_00146246 predicted 718
7 SASI_Mm02_00326921 predicted 592
8 SASI_Mm01_00146247 predicted 962
9 SASI_Mm01_00146248 predicted 378
10 SASI_Mm01_00146249 predicted 513
11 SASI_Mm01_00146245 predicted 341
12 SASI_Mm01_00146250 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025234
VALIDATED
WDR61 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 61
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-868s1c1
Sequence:CCGGGACTTGTGTTCACACCTTCTTCTCGAGAAGAAGGTGTGAACACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025234.1-707s1c1
Sequence:CCGGGATGGCTACATCAAGATCTATCTCGAGATAGATCTTGATGTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-1052s1c1
Sequence:CCGGCCTTACCTTCTTAGGCTTGTTCTCGAGAACAAGCCTAAGAAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025234.1-1053s1c1
Sequence:CCGGCTTACCTTCTTAGGCTTGTTTCTCGAGAAACAAGCCTAAGAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025234.1-959s1c1
Sequence:CCGGGACCAGGAAATTCACATCTATCTCGAGATAGATGTGAATTTCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-996s1c1
Sequence:CCGGCATCAAAGTCTCCAGGCTTATCTCGAGATAAGCCTGGAGACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-868s21c1
Sequence:CCGGGACTTGTGTTCACACCTTCTTCTCGAGAAGAAGGTGTGAACACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-996s21c1
Sequence:CCGGCATCAAAGTCTCCAGGCTTATCTCGAGATAAGCCTGGAGACTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-1052s21c1
Sequence:CCGGCCTTACCTTCTTAGGCTTGTTCTCGAGAACAAGCCTAAGAAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025234.1-453s21c1
Sequence:CCGGATGTCGGGAAAGTGAACATTTCTCGAGAAATGTTCACTTTCCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025234
VALIDATED
WDR61 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 61
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-868s1c1
Sequence:CCGGGACTTGTGTTCACACCTTCTTCTCGAGAAGAAGGTGTGAACACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025234.1-707s1c1
Sequence:CCGGGATGGCTACATCAAGATCTATCTCGAGATAGATCTTGATGTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-1052s1c1
Sequence:CCGGCCTTACCTTCTTAGGCTTGTTCTCGAGAACAAGCCTAAGAAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025234.1-1053s1c1
Sequence:CCGGCTTACCTTCTTAGGCTTGTTTCTCGAGAAACAAGCCTAAGAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025234.1-959s1c1
Sequence:CCGGGACCAGGAAATTCACATCTATCTCGAGATAGATGTGAATTTCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-996s1c1
Sequence:CCGGCATCAAAGTCTCCAGGCTTATCTCGAGATAAGCCTGGAGACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-868s21c1
Sequence:CCGGGACTTGTGTTCACACCTTCTTCTCGAGAAGAAGGTGTGAACACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-996s21c1
Sequence:CCGGCATCAAAGTCTCCAGGCTTATCTCGAGATAAGCCTGGAGACTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-1052s21c1
Sequence:CCGGCCTTACCTTCTTAGGCTTGTTCTCGAGAACAAGCCTAAGAAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025234.1-453s21c1
Sequence:CCGGATGTCGGGAAAGTGAACATTTCTCGAGAAATGTTCACTTTCCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025234
VALIDATED
WDR61 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 61
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-868s1c1
Sequence:CCGGGACTTGTGTTCACACCTTCTTCTCGAGAAGAAGGTGTGAACACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025234.1-707s1c1
Sequence:CCGGGATGGCTACATCAAGATCTATCTCGAGATAGATCTTGATGTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-1052s1c1
Sequence:CCGGCCTTACCTTCTTAGGCTTGTTCTCGAGAACAAGCCTAAGAAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025234.1-1053s1c1
Sequence:CCGGCTTACCTTCTTAGGCTTGTTTCTCGAGAAACAAGCCTAAGAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025234.1-959s1c1
Sequence:CCGGGACCAGGAAATTCACATCTATCTCGAGATAGATGTGAATTTCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025234.1-996s1c1
Sequence:CCGGCATCAAAGTCTCCAGGCTTATCTCGAGATAAGCCTGGAGACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-868s21c1
Sequence:CCGGGACTTGTGTTCACACCTTCTTCTCGAGAAGAAGGTGTGAACACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-996s21c1
Sequence:CCGGCATCAAAGTCTCCAGGCTTATCTCGAGATAAGCCTGGAGACTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025234.1-1052s21c1
Sequence:CCGGCCTTACCTTCTTAGGCTTGTTCTCGAGAACAAGCCTAAGAAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025234.1-453s21c1
Sequence:CCGGATGTCGGGAAAGTGAACATTTCTCGAGAAATGTTCACTTTCCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023191
VALIDATED
WDR61 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 61
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023191.1-113s1c1
Sequence:CCGGCCCATGATGATGCCATATGGTCTCGAGACCATATGGCATCATCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-394s1c1
Sequence:CCGGGATGCCTGGACTTTGGCATTTCTCGAGAAATGCCAAAGTCCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-1034s1c1
Sequence:CCGGGATCATGACATTCCTCAGATTCTCGAGAATCTGAGGAATGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-1025s1c1
Sequence:CCGGCACAGGGTTGATCATGACATTCTCGAGAATGTCATGATCAACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-571s1c1
Sequence:CCGGGCCATAGACGGAATCATCAATCTCGAGATTGATGATTCCGTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-967s1c1
Sequence:CCGGCATGTCTATGACTGCCCAATTCTCGAGAATTGGGCAGTCATAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-592s21c1
Sequence:CCGGGCCATAGACGGAATCATCAATCTCGAGATTGATGATTCCGTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-336s21c1
Sequence:CCGGCAGCTCTCTAGACGCTCATATCTCGAGATATGAGCGTCTAGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023191.2-887s1c1
Sequence:CCGGCCTGTATTCACACCTTCTTTGCTCGAGCAAAGAAGGTGTGAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-1046s21c1
Sequence:CCGGCACAGGGTTGATCATGACATTCTCGAGAATGTCATGATCAACCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-541s21c1
Sequence:CCGGTTCATCCTTAGTATTGCATATCTCGAGATATGCAATACTAAGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-415s21c1
Sequence:CCGGGATGCCTGGACTTTGGCATTTCTCGAGAAATGCCAAAGTCCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023191
VALIDATED
WDR61 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 61
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023191.1-113s1c1
Sequence:CCGGCCCATGATGATGCCATATGGTCTCGAGACCATATGGCATCATCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-394s1c1
Sequence:CCGGGATGCCTGGACTTTGGCATTTCTCGAGAAATGCCAAAGTCCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-1034s1c1
Sequence:CCGGGATCATGACATTCCTCAGATTCTCGAGAATCTGAGGAATGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-1025s1c1
Sequence:CCGGCACAGGGTTGATCATGACATTCTCGAGAATGTCATGATCAACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-571s1c1
Sequence:CCGGGCCATAGACGGAATCATCAATCTCGAGATTGATGATTCCGTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-967s1c1
Sequence:CCGGCATGTCTATGACTGCCCAATTCTCGAGAATTGGGCAGTCATAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-592s21c1
Sequence:CCGGGCCATAGACGGAATCATCAATCTCGAGATTGATGATTCCGTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-336s21c1
Sequence:CCGGCAGCTCTCTAGACGCTCATATCTCGAGATATGAGCGTCTAGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023191.2-887s1c1
Sequence:CCGGCCTGTATTCACACCTTCTTTGCTCGAGCAAAGAAGGTGTGAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-1046s21c1
Sequence:CCGGCACAGGGTTGATCATGACATTCTCGAGAATGTCATGATCAACCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-541s21c1
Sequence:CCGGTTCATCCTTAGTATTGCATATCTCGAGATATGCAATACTAAGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-415s21c1
Sequence:CCGGGATGCCTGGACTTTGGCATTTCTCGAGAAATGCCAAAGTCCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023191
VALIDATED
WDR61 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 61
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023191.1-113s1c1
Sequence:CCGGCCCATGATGATGCCATATGGTCTCGAGACCATATGGCATCATCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-394s1c1
Sequence:CCGGGATGCCTGGACTTTGGCATTTCTCGAGAAATGCCAAAGTCCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-1034s1c1
Sequence:CCGGGATCATGACATTCCTCAGATTCTCGAGAATCTGAGGAATGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-1025s1c1
Sequence:CCGGCACAGGGTTGATCATGACATTCTCGAGAATGTCATGATCAACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-571s1c1
Sequence:CCGGGCCATAGACGGAATCATCAATCTCGAGATTGATGATTCCGTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023191.1-967s1c1
Sequence:CCGGCATGTCTATGACTGCCCAATTCTCGAGAATTGGGCAGTCATAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-592s21c1
Sequence:CCGGGCCATAGACGGAATCATCAATCTCGAGATTGATGATTCCGTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-336s21c1
Sequence:CCGGCAGCTCTCTAGACGCTCATATCTCGAGATATGAGCGTCTAGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023191.2-887s1c1
Sequence:CCGGCCTGTATTCACACCTTCTTTGCTCGAGCAAAGAAGGTGTGAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-1046s21c1
Sequence:CCGGCACAGGGTTGATCATGACATTCTCGAGAATGTCATGATCAACCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-541s21c1
Sequence:CCGGTTCATCCTTAGTATTGCATATCTCGAGATATGCAATACTAAGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023191.2-415s21c1
Sequence:CCGGGATGCCTGGACTTTGGCATTTCTCGAGAAATGCCAAAGTCCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks