EMAIL THIS PAGE TO A FRIEND

WDR62

WD repeat domain 62

Synonyms: C19orf14 MCPH2
UniProtKB ID: O43379, Q63HP9, Q659D7, Q8NBF7, Q96AD9
Gene ID:
Human(284403) Summary: This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
Mouse(233064) WD repeat domain 62
Rat(308492) WD repeat domain 62
domestic cat(101096774) WD repeat domain 62
dog(484565) WD repeat domain 62
cow(530449) WD repeat domain 62
sheep(101106356) WD repeat domain 62
naked mole-rat(101712914) WD repeat domain 62
domestic guinea pig(100714291) WD repeat domain 62
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083961 Rosetta Predictions human pricing
NM_173636 Rosetta Predictions human pricing
XM_001075797 Rosetta Predictions rat pricing
XM_001075814 Rosetta Predictions rat pricing
XM_001075831 Rosetta Predictions rat pricing
XM_218479 Rosetta Predictions rat pricing
XM_001479182 Rosetta Predictions mouse pricing
XM_891376 Rosetta Predictions mouse pricing
XM_899568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317371 predicted 1422
2 SASI_Hs02_00317372 predicted 1841
3 SASI_Hs02_00317373 predicted 1836
4 SASI_Hs02_00317374 predicted 2261
5 SASI_Hs02_00317375 predicted 2178
6 SASI_Hs02_00317376 predicted 1234
7 SASI_Hs02_00317377 predicted 2240
8 SASI_Hs02_00317378 predicted 535
9 SASI_Hs02_00317379 predicted 671
10 SASI_Hs02_00317380 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011678 predicted 1420
2 SASI_Hs01_00011679 predicted 1842
3 SASI_Hs01_00011680 predicted 1835
4 SASI_Hs01_00011681 predicted 2262
5 SASI_Hs02_00368527 predicted 2172
6 SASI_Hs01_00011683 predicted 1228
7 SASI_Hs01_00011684 predicted 2247
8 SASI_Hs01_00011685 predicted 531
9 SASI_Hs01_00011686 predicted 677
10 SASI_Hs01_00011687 predicted 1369
11 SASI_Hs01_00011682 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351080 predicted 1988
2 SASI_Rn02_00351081 predicted 4406
3 SASI_Rn02_00351082 predicted 388
4 SASI_Rn02_00351083 predicted 1839
5 SASI_Rn02_00351084 predicted 1231
6 SASI_Rn02_00351085 predicted 2751
7 SASI_Rn02_00351086 predicted 2067
8 SASI_Rn02_00351087 predicted 962
9 SASI_Rn02_00351088 predicted 386
10 SASI_Rn02_00351089 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351139 predicted 1989
2 SASI_Rn02_00351140 predicted 4408
3 SASI_Rn02_00351141 predicted 391
4 SASI_Rn02_00351142 predicted 1841
5 SASI_Rn02_00351143 predicted 1233
6 SASI_Rn02_00351144 predicted 2744
7 SASI_Rn02_00351145 predicted 2063
8 SASI_Rn02_00351146 predicted 963
9 SASI_Rn02_00351147 predicted 380
10 SASI_Rn02_00351148 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351217 predicted 1987
2 SASI_Rn02_00351218 predicted 4394
3 SASI_Rn02_00351219 predicted 1834
4 SASI_Rn02_00351220 predicted 394
5 SASI_Rn02_00351221 predicted 1227
6 SASI_Rn02_00351222 predicted 2740
7 SASI_Rn02_00351223 predicted 2055
8 SASI_Rn02_00351224 predicted 959
9 SASI_Rn02_00351225 predicted 386
10 SASI_Rn02_00351226 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377783 predicted 4164
2 SASI_Rn02_00377784 predicted 3646
3 SASI_Rn02_00377785 predicted 4141
4 SASI_Rn02_00377786 predicted 2499
5 SASI_Rn02_00377787 predicted 3129
6 SASI_Rn02_00377788 predicted 3883
7 SASI_Rn02_00377789 predicted 4162
8 SASI_Rn02_00377790 predicted 3823
9 SASI_Rn02_00377791 predicted 3148
10 SASI_Rn02_00377792 predicted 3713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00408199 predicted 1634
2 SASI_Mm02_00408200 predicted 2029
3 SASI_Mm02_00408201 predicted 4177
4 SASI_Mm02_00408202 predicted 481
5 SASI_Mm02_00408203 predicted 2592
6 SASI_Mm02_00408204 predicted 1689
7 SASI_Mm02_00408205 predicted 1100
8 SASI_Mm02_00408206 predicted 1185
9 SASI_Mm02_00408207 predicted 3430
10 SASI_Mm02_00408208 predicted 3760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255656 predicted 4352
2 SASI_Mm01_00255657 predicted 4371
3 SASI_Mm01_00255658 predicted 3881
4 SASI_Mm01_00255659 predicted 4361
5 SASI_Mm01_00255660 predicted 3882
6 SASI_Mm01_00255661 predicted 4454
7 SASI_Mm01_00255662 predicted 4495
8 SASI_Mm01_00255663 predicted 4465
9 SASI_Mm01_00255664 predicted 4473
10 SASI_Mm01_00255665 predicted 3750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202495 predicted 2460
2 SASI_Mm01_00202496 predicted 2479
3 SASI_Mm01_00202497 predicted 1993
4 SASI_Mm01_00202498 predicted 2467
5 SASI_Mm01_00202499 predicted 1994
6 SASI_Mm01_00202500 predicted 2555
7 SASI_Mm01_00202501 predicted 2597
8 SASI_Mm01_00202502 predicted 2569
9 SASI_Mm01_00202503 predicted 2583
10 SASI_Mm01_00202504 predicted 1857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146186
VALIDATED
WDR62 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 62
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146186.3-2220s21c1
Sequence:CCGGATGTTTGGCCATTCGGAAATTCTCGAGAATTTCCGAATGGCCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-389s21c1
Sequence:CCGGGAACAAGCAGCAGCATATATTCTCGAGAATATATGCTGCTGCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146186.3-3401s21c1
Sequence:CCGGCTCAGAGACTGAGGACTATTTCTCGAGAAATAGTCCTCAGTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-3012s21c1
Sequence:CCGGGGGATGCACAGGGAGTATTATCTCGAGATAATACTCCCTGTGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-2559s21c1
Sequence:CCGGCCTCGATGCCTGCTGACAAATCTCGAGATTTGTCAGCAGGCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146186
VALIDATED
WDR62 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 62
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146186.3-2220s21c1
Sequence:CCGGATGTTTGGCCATTCGGAAATTCTCGAGAATTTCCGAATGGCCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-389s21c1
Sequence:CCGGGAACAAGCAGCAGCATATATTCTCGAGAATATATGCTGCTGCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146186.3-3401s21c1
Sequence:CCGGCTCAGAGACTGAGGACTATTTCTCGAGAAATAGTCCTCAGTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-3012s21c1
Sequence:CCGGGGGATGCACAGGGAGTATTATCTCGAGATAATACTCCCTGTGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-2559s21c1
Sequence:CCGGCCTCGATGCCTGCTGACAAATCTCGAGATTTGTCAGCAGGCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146186
VALIDATED
WDR62 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 62
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146186.3-2220s21c1
Sequence:CCGGATGTTTGGCCATTCGGAAATTCTCGAGAATTTCCGAATGGCCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-389s21c1
Sequence:CCGGGAACAAGCAGCAGCATATATTCTCGAGAATATATGCTGCTGCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146186.3-3401s21c1
Sequence:CCGGCTCAGAGACTGAGGACTATTTCTCGAGAAATAGTCCTCAGTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-3012s21c1
Sequence:CCGGGGGATGCACAGGGAGTATTATCTCGAGATAATACTCCCTGTGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146186.3-2559s21c1
Sequence:CCGGCCTCGATGCCTGCTGACAAATCTCGAGATTTGTCAGCAGGCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173636
VALIDATED
WDR62 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 62
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173636.4-1206s21c1
Sequence:CCGGAGTGGCTGTCCTGCGTGTATACTCGAGTATACACGCAGGACAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173636.4-1929s21c1
Sequence:CCGGGTTCGGATGGACTACACTTTGCTCGAGCAAAGTGTAGTCCATCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173636.4-2730s21c1
Sequence:CCGGAGGACCTGGATTGCTACTTTACTCGAGTAAAGTAGCAATCCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173636.4-4360s21c1
Sequence:CCGGCCAAGAAGCCCTCGACCTTTACTCGAGTAAAGGTCGAGGGCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-1356s1c1
Sequence:CCGGCAACACCATTCGCTTCTGGAACTCGAGTTCCAGAAGCGAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-2301s1c1
Sequence:CCGGCAACTGCATGAAGCAGCACTTCTCGAGAAGTGCTGCTTCATGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-2497s1c1
Sequence:CCGGCCATCCAAAGATAGCTTGGATCTCGAGATCCAAGCTATCTTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173636
VALIDATED
WDR62 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 62
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173636.4-1206s21c1
Sequence:CCGGAGTGGCTGTCCTGCGTGTATACTCGAGTATACACGCAGGACAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173636.4-1929s21c1
Sequence:CCGGGTTCGGATGGACTACACTTTGCTCGAGCAAAGTGTAGTCCATCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173636.4-2730s21c1
Sequence:CCGGAGGACCTGGATTGCTACTTTACTCGAGTAAAGTAGCAATCCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173636.4-4360s21c1
Sequence:CCGGCCAAGAAGCCCTCGACCTTTACTCGAGTAAAGGTCGAGGGCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-1356s1c1
Sequence:CCGGCAACACCATTCGCTTCTGGAACTCGAGTTCCAGAAGCGAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-2301s1c1
Sequence:CCGGCAACTGCATGAAGCAGCACTTCTCGAGAAGTGCTGCTTCATGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-2497s1c1
Sequence:CCGGCCATCCAAAGATAGCTTGGATCTCGAGATCCAAGCTATCTTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173636
VALIDATED
WDR62 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 62
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173636.4-1206s21c1
Sequence:CCGGAGTGGCTGTCCTGCGTGTATACTCGAGTATACACGCAGGACAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173636.4-1929s21c1
Sequence:CCGGGTTCGGATGGACTACACTTTGCTCGAGCAAAGTGTAGTCCATCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173636.4-2730s21c1
Sequence:CCGGAGGACCTGGATTGCTACTTTACTCGAGTAAAGTAGCAATCCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173636.4-4360s21c1
Sequence:CCGGCCAAGAAGCCCTCGACCTTTACTCGAGTAAAGGTCGAGGGCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-1356s1c1
Sequence:CCGGCAACACCATTCGCTTCTGGAACTCGAGTTCCAGAAGCGAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-2301s1c1
Sequence:CCGGCAACTGCATGAAGCAGCACTTCTCGAGAAGTGCTGCTTCATGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173636.3-2497s1c1
Sequence:CCGGCCATCCAAAGATAGCTTGGATCTCGAGATCCAAGCTATCTTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks