EMAIL THIS PAGE TO A FRIEND

WDR63

WD repeat domain 63

Synonyms: DIC3 NYD-SP29 RP11-507C22.2
UniProtKB ID: Q8IWG1, A8K988, Q96L72, Q96NU4
Gene ID:
Mouse(242253) WD repeat domain 63
Rat(292165) WD repeat domain 63
domestic guinea pig(100735511) WD repeat domain 63
naked mole-rat(101714450) WD repeat domain 63
cow(520702) WD repeat domain 63
sheep(101112532) WD repeat domain 63
chicken(429090) WD repeat domain 63
domestic cat(101091957) WD repeat domain 63
Horse(100064323) WD repeat domain 63
dog(479968) WD repeat domain 63
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145172 Rosetta Predictions human pricing
NM_001134736 Rosetta Predictions rat pricing
XM_217682 Rosetta Predictions rat pricing
NM_172864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241386 predicted 1698
2 SASI_Hs01_00241387 predicted 1213
3 SASI_Hs01_00241388 predicted 2272
4 SASI_Hs01_00241389 predicted 2269
5 SASI_Hs01_00241390 predicted 778
6 SASI_Hs01_00241391 predicted 2139
7 SASI_Hs01_00241392 predicted 751
8 SASI_Hs01_00241393 predicted 475
9 SASI_Hs01_00241394 predicted 759
10 SASI_Hs01_00241395 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258254 predicted 275
2 SASI_Rn02_00258255 predicted 241
3 SASI_Rn02_00258256 predicted 721
4 SASI_Rn02_00258257 predicted 778
5 SASI_Rn02_00258258 predicted 1224
6 SASI_Rn02_00258259 predicted 801
7 SASI_Rn02_00258260 predicted 1888
8 SASI_Rn02_00258261 predicted 1468
9 SASI_Rn02_00258262 predicted 2589
10 SASI_Rn02_00258263 predicted 2616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188707 predicted 920
2 SASI_Rn01_00188708 predicted 996
3 SASI_Rn01_00188709 predicted 519
4 SASI_Rn01_00188710 predicted 857
5 SASI_Rn01_00188711 predicted 584
6 SASI_Rn01_00188712 predicted 922
7 SASI_Rn01_00188713 predicted 553
8 SASI_Rn01_00188714 predicted 844
9 SASI_Rn01_00188715 predicted 505
10 SASI_Rn01_00188716 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196585 predicted 1912
2 SASI_Mm01_00196586 predicted 2089
3 SASI_Mm01_00196587 predicted 2823
4 SASI_Mm01_00196588 predicted 2544
5 SASI_Mm01_00196589 predicted 716
6 SASI_Mm01_00196590 predicted 2012
7 SASI_Mm01_00196591 predicted 1029
8 SASI_Mm02_00344825 predicted 1334
9 SASI_Mm01_00196592 predicted 2601
10 SASI_Mm01_00196593 predicted 1038
11 SASI_Mm01_00196594 predicted 1227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145172
WDR63 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 63
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-476s1c1
Sequence:CCGGCCTGGAAATGAGCTTCTGCTTCTCGAGAAGCAGAAGCTCATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2273s1c1
Sequence:CCGGGCCATATGGAAAGAAGGTGTTCTCGAGAACACCTTCTTTCCATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-2274s1c1
Sequence:CCGGCCATATGGAAAGAAGGTGTTACTCGAGTAACACCTTCTTTCCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-2815s1c1
Sequence:CCGGCCTAATCAAAGTCACAGAGAACTCGAGTTCTCTGTGACTTTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1220s1c1
Sequence:CCGGCCAACTATCTATGGGCTAATACTCGAGTATTAGCCCATAGATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1031s1c1
Sequence:CCGGGCATCCATAAGTGTTGAAATACTCGAGTATTTCAACACTTATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1403s1c1
Sequence:CCGGCCGAGTGATCCTAATATCATTCTCGAGAATGATATTAGGATCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-252s1c1
Sequence:CCGGGTGAAGACATGGAACCAGTAACTCGAGTTACTGGTTCCATGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2622s1c1
Sequence:CCGGGAGAAGTCAAGCATCTGGAATCTCGAGATTCCAGATGCTTGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1694s1c1
Sequence:CCGGCGAAGTGGAATATGCTGTCAACTCGAGTTGACAGCATATTCCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1677s1c1
Sequence:CCGGGCTCCGTCTTTGAGAATCGAACTCGAGTTCGATTCTCAAAGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2798s1c1
Sequence:CCGGGTTCTTATCAACCTTGGCCTACTCGAGTAGGCCAAGGTTGATAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1523s1c1
Sequence:CCGGGCCACACTGAAGCCTATGTTTCTCGAGAAACATAGGCTTCAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145172
WDR63 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 63
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-476s1c1
Sequence:CCGGCCTGGAAATGAGCTTCTGCTTCTCGAGAAGCAGAAGCTCATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2273s1c1
Sequence:CCGGGCCATATGGAAAGAAGGTGTTCTCGAGAACACCTTCTTTCCATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-2274s1c1
Sequence:CCGGCCATATGGAAAGAAGGTGTTACTCGAGTAACACCTTCTTTCCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-2815s1c1
Sequence:CCGGCCTAATCAAAGTCACAGAGAACTCGAGTTCTCTGTGACTTTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1220s1c1
Sequence:CCGGCCAACTATCTATGGGCTAATACTCGAGTATTAGCCCATAGATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1031s1c1
Sequence:CCGGGCATCCATAAGTGTTGAAATACTCGAGTATTTCAACACTTATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1403s1c1
Sequence:CCGGCCGAGTGATCCTAATATCATTCTCGAGAATGATATTAGGATCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-252s1c1
Sequence:CCGGGTGAAGACATGGAACCAGTAACTCGAGTTACTGGTTCCATGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2622s1c1
Sequence:CCGGGAGAAGTCAAGCATCTGGAATCTCGAGATTCCAGATGCTTGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1694s1c1
Sequence:CCGGCGAAGTGGAATATGCTGTCAACTCGAGTTGACAGCATATTCCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1677s1c1
Sequence:CCGGGCTCCGTCTTTGAGAATCGAACTCGAGTTCGATTCTCAAAGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2798s1c1
Sequence:CCGGGTTCTTATCAACCTTGGCCTACTCGAGTAGGCCAAGGTTGATAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1523s1c1
Sequence:CCGGGCCACACTGAAGCCTATGTTTCTCGAGAAACATAGGCTTCAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145172
WDR63 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 63
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-476s1c1
Sequence:CCGGCCTGGAAATGAGCTTCTGCTTCTCGAGAAGCAGAAGCTCATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2273s1c1
Sequence:CCGGGCCATATGGAAAGAAGGTGTTCTCGAGAACACCTTCTTTCCATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-2274s1c1
Sequence:CCGGCCATATGGAAAGAAGGTGTTACTCGAGTAACACCTTCTTTCCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-2815s1c1
Sequence:CCGGCCTAATCAAAGTCACAGAGAACTCGAGTTCTCTGTGACTTTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1220s1c1
Sequence:CCGGCCAACTATCTATGGGCTAATACTCGAGTATTAGCCCATAGATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1031s1c1
Sequence:CCGGGCATCCATAAGTGTTGAAATACTCGAGTATTTCAACACTTATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145172.1-1403s1c1
Sequence:CCGGCCGAGTGATCCTAATATCATTCTCGAGAATGATATTAGGATCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-252s1c1
Sequence:CCGGGTGAAGACATGGAACCAGTAACTCGAGTTACTGGTTCCATGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2622s1c1
Sequence:CCGGGAGAAGTCAAGCATCTGGAATCTCGAGATTCCAGATGCTTGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1694s1c1
Sequence:CCGGCGAAGTGGAATATGCTGTCAACTCGAGTTGACAGCATATTCCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1677s1c1
Sequence:CCGGGCTCCGTCTTTGAGAATCGAACTCGAGTTCGATTCTCAAAGACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-2798s1c1
Sequence:CCGGGTTCTTATCAACCTTGGCCTACTCGAGTAGGCCAAGGTTGATAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145172.1-1523s1c1
Sequence:CCGGGCCACACTGAAGCCTATGTTTCTCGAGAAACATAGGCTTCAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172864
WDR63 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 63
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-1613s1c1
Sequence:CCGGGCCCGACTCATTCGAGATTAACTCGAGTTAATCTCGAATGAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-2097s1c1
Sequence:CCGGGCCAATATCCTCAAGCCGATACTCGAGTATCGGCTTGAGGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-2024s1c1
Sequence:CCGGCAAGATGTTAAGTCAGATCAACTCGAGTTGATCTGACTTAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-774s1c1
Sequence:CCGGGCCTACATTGAGTGTACGTCTCTCGAGAGACGTACACTCAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-775s1c1
Sequence:CCGGCCTACATTGAGTGTACGTCTTCTCGAGAAGACGTACACTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172864.3-1787s21c1
Sequence:CCGGACGCAAACTCCCAGCAATCACCTCGAGGTGATTGCTGGGAGTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172864.3-2005s21c1
Sequence:CCGGCATATTATTCTGAGAGACAAGCTCGAGCTTGTCTCTCAGAATAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172864
WDR63 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 63
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-1613s1c1
Sequence:CCGGGCCCGACTCATTCGAGATTAACTCGAGTTAATCTCGAATGAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-2097s1c1
Sequence:CCGGGCCAATATCCTCAAGCCGATACTCGAGTATCGGCTTGAGGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-2024s1c1
Sequence:CCGGCAAGATGTTAAGTCAGATCAACTCGAGTTGATCTGACTTAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-774s1c1
Sequence:CCGGGCCTACATTGAGTGTACGTCTCTCGAGAGACGTACACTCAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-775s1c1
Sequence:CCGGCCTACATTGAGTGTACGTCTTCTCGAGAAGACGTACACTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172864.3-1787s21c1
Sequence:CCGGACGCAAACTCCCAGCAATCACCTCGAGGTGATTGCTGGGAGTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172864.3-2005s21c1
Sequence:CCGGCATATTATTCTGAGAGACAAGCTCGAGCTTGTCTCTCAGAATAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172864
WDR63 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 63
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-1613s1c1
Sequence:CCGGGCCCGACTCATTCGAGATTAACTCGAGTTAATCTCGAATGAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-2097s1c1
Sequence:CCGGGCCAATATCCTCAAGCCGATACTCGAGTATCGGCTTGAGGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-2024s1c1
Sequence:CCGGCAAGATGTTAAGTCAGATCAACTCGAGTTGATCTGACTTAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-774s1c1
Sequence:CCGGGCCTACATTGAGTGTACGTCTCTCGAGAGACGTACACTCAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172864.1-775s1c1
Sequence:CCGGCCTACATTGAGTGTACGTCTTCTCGAGAAGACGTACACTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172864.3-1787s21c1
Sequence:CCGGACGCAAACTCCCAGCAATCACCTCGAGGTGATTGCTGGGAGTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172864.3-2005s21c1
Sequence:CCGGCATATTATTCTGAGAGACAAGCTCGAGCTTGTCTCTCAGAATAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks