EMAIL THIS PAGE TO A FRIEND

WDR64

WD repeat domain 64

UniProtKB ID: B1ANS9, B1ANT0, Q7Z573, Q96LY9
Gene ID:
Mouse(75820) WD repeat domain 64
Rat(689524) WD repeat domain 64
chicken(428581) WD repeat domain 64
Horse(100060549) WD repeat domain 64
domestic cat(101095305) WD repeat domain 64
dog(100684626) WD repeat domain 64
cow(783230) WD repeat domain 64
sheep(101120508) WD repeat domain 64
naked mole-rat(101717675) WD repeat domain 64
domestic guinea pig(100728901) WD repeat domain 64
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213301 MISSION® esiRNA esiRNA targeting mouse Wdr64 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144625 Rosetta Predictions human pricing
XM_001071080 Rosetta Predictions rat pricing
NM_029453 Rosetta Predictions mouse pricing
XM_001472727 Rosetta Predictions mouse pricing
XM_001474997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364444 predicted 1275
2 SASI_Hs02_00364445 predicted 596
3 SASI_Hs01_00167039 predicted 192
4 SASI_Hs01_00167040 predicted 239
5 SASI_Hs02_00364446 predicted 624
6 SASI_Hs02_00364447 predicted 553
7 SASI_Hs01_00167041 predicted 863
8 SASI_Hs01_00167042 predicted 821
9 SASI_Hs01_00167045 predicted 1650
10 SASI_Hs01_00167046 predicted 718
11 SASI_Hs01_00167038 predicted 205
12 SASI_Hs01_00167043 predicted 1419
13 SASI_Hs01_00167044 predicted 1120
14 SASI_Hs01_00167047 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333805 predicted 497
2 SASI_Rn02_00333806 predicted 2104
3 SASI_Rn02_00333807 predicted 2683
4 SASI_Rn02_00333808 predicted 1502
5 SASI_Rn02_00333809 predicted 1233
6 SASI_Rn02_00333810 predicted 542
7 SASI_Rn02_00333811 predicted 1553
8 SASI_Rn02_00333812 predicted 2672
9 SASI_Rn02_00333813 predicted 1420
10 SASI_Rn02_00333814 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194839 predicted 1519
2 SASI_Mm01_00194840 predicted 575
3 SASI_Mm01_00194841 predicted 707
4 SASI_Mm01_00194842 predicted 1158
5 SASI_Mm01_00194843 predicted 1454
6 SASI_Mm01_00194844 predicted 500
7 SASI_Mm01_00194845 predicted 1356
8 SASI_Mm01_00194846 predicted 474
9 SASI_Mm01_00194847 predicted 1542
10 SASI_Mm01_00194848 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00363406 predicted 2960
2 SASI_Mm02_00363407 predicted 256
3 SASI_Mm02_00363408 predicted 1747
4 SASI_Mm02_00363409 predicted 548
5 SASI_Mm02_00363410 predicted 3158
6 SASI_Mm02_00363411 predicted 303
7 SASI_Mm02_00363412 predicted 1506
8 SASI_Mm02_00363413 predicted 693
9 SASI_Mm02_00363414 predicted 1426
10 SASI_Mm02_00363415 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00379377 predicted 1694
2 SASI_Mm02_00379378 predicted 2086
3 SASI_Mm02_00379379 predicted 2214
4 SASI_Mm02_00379380 predicted 2669
5 SASI_Mm02_00379381 predicted 2958
6 SASI_Mm02_00379382 predicted 2861
7 SASI_Mm02_00379383 predicted 1741
8 SASI_Mm02_00379384 predicted 3161
9 SASI_Mm02_00379385 predicted 2904
10 SASI_Mm02_00379386 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144625
WDR64 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 64
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-590s1c1
Sequence:CCGGGCATGCTTATTACGGGATCTACTCGAGTAGATCCCGTAATAAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-1888s1c1
Sequence:CCGGCTTCCACTGATTGGCGTAGAACTCGAGTTCTACGCCAATCAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-577s1c1
Sequence:CCGGGATGCCAATCATGGCATGCTTCTCGAGAAGCATGCCATGATTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-2011s1c1
Sequence:CCGGCCACAAATAAATCTGGCTTCTCTCGAGAGAAGCCAGATTTATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-621s1c1
Sequence:CCGGCATGTATCCTTTGACTAGGATCTCGAGATCCTAGTCAAAGGATACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144625
WDR64 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 64
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-590s1c1
Sequence:CCGGGCATGCTTATTACGGGATCTACTCGAGTAGATCCCGTAATAAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-1888s1c1
Sequence:CCGGCTTCCACTGATTGGCGTAGAACTCGAGTTCTACGCCAATCAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-577s1c1
Sequence:CCGGGATGCCAATCATGGCATGCTTCTCGAGAAGCATGCCATGATTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-2011s1c1
Sequence:CCGGCCACAAATAAATCTGGCTTCTCTCGAGAGAAGCCAGATTTATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-621s1c1
Sequence:CCGGCATGTATCCTTTGACTAGGATCTCGAGATCCTAGTCAAAGGATACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144625
WDR64 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 64
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-590s1c1
Sequence:CCGGGCATGCTTATTACGGGATCTACTCGAGTAGATCCCGTAATAAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-1888s1c1
Sequence:CCGGCTTCCACTGATTGGCGTAGAACTCGAGTTCTACGCCAATCAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-577s1c1
Sequence:CCGGGATGCCAATCATGGCATGCTTCTCGAGAAGCATGCCATGATTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-2011s1c1
Sequence:CCGGCCACAAATAAATCTGGCTTCTCTCGAGAGAAGCCAGATTTATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144625.2-621s1c1
Sequence:CCGGCATGTATCCTTTGACTAGGATCTCGAGATCCTAGTCAAAGGATACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029453
WDR64 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 64
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029453.1-1657s1c1
Sequence:CCGGGCTCTGAAGTACAAAGAGATTCTCGAGAATCTCTTTGTACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-1412s1c1
Sequence:CCGGCCCAAACAAGTGACTTCATTTCTCGAGAAATGAAGTCACTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-668s1c1
Sequence:CCGGGCACAACAAATGGCATGATAACTCGAGTTATCATGCCATTTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-1527s1c1
Sequence:CCGGCCGTGAAAGATTCGCCGATATCTCGAGATATCGGCGAATCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-466s1c1
Sequence:CCGGGCCATGCCTTACCTACAATATCTCGAGATATTGTAGGTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029453
WDR64 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 64
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029453.1-1657s1c1
Sequence:CCGGGCTCTGAAGTACAAAGAGATTCTCGAGAATCTCTTTGTACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-1412s1c1
Sequence:CCGGCCCAAACAAGTGACTTCATTTCTCGAGAAATGAAGTCACTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-668s1c1
Sequence:CCGGGCACAACAAATGGCATGATAACTCGAGTTATCATGCCATTTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-1527s1c1
Sequence:CCGGCCGTGAAAGATTCGCCGATATCTCGAGATATCGGCGAATCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-466s1c1
Sequence:CCGGGCCATGCCTTACCTACAATATCTCGAGATATTGTAGGTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029453
WDR64 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 64
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029453.1-1657s1c1
Sequence:CCGGGCTCTGAAGTACAAAGAGATTCTCGAGAATCTCTTTGTACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-1412s1c1
Sequence:CCGGCCCAAACAAGTGACTTCATTTCTCGAGAAATGAAGTCACTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-668s1c1
Sequence:CCGGGCACAACAAATGGCATGATAACTCGAGTTATCATGCCATTTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-1527s1c1
Sequence:CCGGCCGTGAAAGATTCGCCGATATCTCGAGATATCGGCGAATCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029453.1-466s1c1
Sequence:CCGGGCCATGCCTTACCTACAATATCTCGAGATATTGTAGGTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks