EMAIL THIS PAGE TO A FRIEND

WDR65

WD repeat domain 65

Synonyms: VWS2
UniProtKB ID: Q96MR6, A6NKQ3, Q17RI9, Q5TAI0
Gene ID:
Human(149465) Summary: This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(68625) WD repeat domain 65
domestic guinea pig(100717426) WD repeat domain 65
naked mole-rat(101701982) WD repeat domain 65
sheep(101106130) WD repeat domain 65
Zebrafish(100006472) WD repeat domain 65
chicken(424559) WD repeat domain 65
dog(475390) WD repeat domain 65
Horse(100053447) WD repeat domain 65
domestic cat(101101652) WD repeat domain 65
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152498 Rosetta Predictions human pricing
NM_026789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214408 predicted 1589
2 SASI_Hs01_00214409 predicted 1652
3 SASI_Hs01_00214410 predicted 770
4 SASI_Hs01_00214411 predicted 200
5 SASI_Hs01_00214412 predicted 1112
6 SASI_Hs01_00214413 predicted 1187
7 SASI_Hs02_00366274 predicted 290
8 SASI_Hs01_00214415 predicted 1486
9 SASI_Hs02_00366275 predicted 1415
10 SASI_Hs01_00214416 predicted 1525
11 SASI_Hs01_00214414 predicted 483
12 SASI_Hs01_00214417 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197894 predicted 303
2 SASI_Mm01_00197895 predicted 239
3 SASI_Mm01_00197896 predicted 219
4 SASI_Mm01_00197897 predicted 291
5 SASI_Mm01_00197898 predicted 250
6 SASI_Mm01_00197899 predicted 258
7 SASI_Mm01_00197900 predicted 252
8 SASI_Mm01_00197902 predicted 235
9 SASI_Mm01_00197903 predicted 244
10 SASI_Mm02_00330897 predicted 198
11 SASI_Mm01_00197901 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026789
WDR65 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 65
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-158s1c1
Sequence:CCGGCGCTCCCAAATCTATGACCTTCTCGAGAAGGTCATAGATTTGGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-176s1c1
Sequence:CCGGCTTGAATCGGCCCTGAAAGTACTCGAGTACTTTCAGGGCCGATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-409s1c1
Sequence:CCGGCGTCGACTCAGATGTGGATTTCTCGAGAAATCCACATCTGAGTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026789.1-186s1c1
Sequence:CCGGCCCTGAAAGTATCCAAGAAGACTCGAGTCTTCTTGGATACTTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-307s1c1
Sequence:CCGGCGAGATGCAACGTCTGGAAATCTCGAGATTTCCAGACGTTGCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026789
WDR65 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 65
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-158s1c1
Sequence:CCGGCGCTCCCAAATCTATGACCTTCTCGAGAAGGTCATAGATTTGGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-176s1c1
Sequence:CCGGCTTGAATCGGCCCTGAAAGTACTCGAGTACTTTCAGGGCCGATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-409s1c1
Sequence:CCGGCGTCGACTCAGATGTGGATTTCTCGAGAAATCCACATCTGAGTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026789.1-186s1c1
Sequence:CCGGCCCTGAAAGTATCCAAGAAGACTCGAGTCTTCTTGGATACTTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-307s1c1
Sequence:CCGGCGAGATGCAACGTCTGGAAATCTCGAGATTTCCAGACGTTGCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026789
WDR65 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 65
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-158s1c1
Sequence:CCGGCGCTCCCAAATCTATGACCTTCTCGAGAAGGTCATAGATTTGGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-176s1c1
Sequence:CCGGCTTGAATCGGCCCTGAAAGTACTCGAGTACTTTCAGGGCCGATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-409s1c1
Sequence:CCGGCGTCGACTCAGATGTGGATTTCTCGAGAAATCCACATCTGAGTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026789.1-186s1c1
Sequence:CCGGCCCTGAAAGTATCCAAGAAGACTCGAGTCTTCTTGGATACTTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026789.1-307s1c1
Sequence:CCGGCGAGATGCAACGTCTGGAAATCTCGAGATTTCCAGACGTTGCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152498
WDR65 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 65
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-544s1c1
Sequence:CCGGCAGAAAGTAATGGCCATTGTTCTCGAGAACAATGGCCATTACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1388s1c1
Sequence:CCGGCCCTGGAACTATTTAAGGAATCTCGAGATTCCTTAAATAGTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152498.1-2239s1c1
Sequence:CCGGGCCTAGGAAATCATCAGAGATCTCGAGATCTCTGATGATTTCCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1776s1c1
Sequence:CCGGGCTCAAGTCTTGCAGCTACAACTCGAGTTGTAGCTGCAAGACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152498.1-2647s1c1
Sequence:CCGGGCAATGTGCTACCACATGGATCTCGAGATCCATGTGGTAGCACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152498.1-2496s1c1
Sequence:CCGGCCTTCCATTCACCCTTCTCATCTCGAGATGAGAAGGGTGAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-1389s1c1
Sequence:CCGGCCTGGAACTATTTAAGGAATACTCGAGTATTCCTTAAATAGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-742s1c1
Sequence:CCGGGCTGATGACAAGATTGTCGTTCTCGAGAACGACAATCTTGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1545s1c1
Sequence:CCGGCGGAGAGTGTTCCTTTAGCAACTCGAGTTGCTAAAGGAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152498
WDR65 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 65
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-544s1c1
Sequence:CCGGCAGAAAGTAATGGCCATTGTTCTCGAGAACAATGGCCATTACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1388s1c1
Sequence:CCGGCCCTGGAACTATTTAAGGAATCTCGAGATTCCTTAAATAGTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152498.1-2239s1c1
Sequence:CCGGGCCTAGGAAATCATCAGAGATCTCGAGATCTCTGATGATTTCCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1776s1c1
Sequence:CCGGGCTCAAGTCTTGCAGCTACAACTCGAGTTGTAGCTGCAAGACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152498.1-2647s1c1
Sequence:CCGGGCAATGTGCTACCACATGGATCTCGAGATCCATGTGGTAGCACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152498.1-2496s1c1
Sequence:CCGGCCTTCCATTCACCCTTCTCATCTCGAGATGAGAAGGGTGAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-1389s1c1
Sequence:CCGGCCTGGAACTATTTAAGGAATACTCGAGTATTCCTTAAATAGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-742s1c1
Sequence:CCGGGCTGATGACAAGATTGTCGTTCTCGAGAACGACAATCTTGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1545s1c1
Sequence:CCGGCGGAGAGTGTTCCTTTAGCAACTCGAGTTGCTAAAGGAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152498
WDR65 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 65
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-544s1c1
Sequence:CCGGCAGAAAGTAATGGCCATTGTTCTCGAGAACAATGGCCATTACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1388s1c1
Sequence:CCGGCCCTGGAACTATTTAAGGAATCTCGAGATTCCTTAAATAGTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152498.1-2239s1c1
Sequence:CCGGGCCTAGGAAATCATCAGAGATCTCGAGATCTCTGATGATTTCCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1776s1c1
Sequence:CCGGGCTCAAGTCTTGCAGCTACAACTCGAGTTGTAGCTGCAAGACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152498.1-2647s1c1
Sequence:CCGGGCAATGTGCTACCACATGGATCTCGAGATCCATGTGGTAGCACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152498.1-2496s1c1
Sequence:CCGGCCTTCCATTCACCCTTCTCATCTCGAGATGAGAAGGGTGAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-1389s1c1
Sequence:CCGGCCTGGAACTATTTAAGGAATACTCGAGTATTCCTTAAATAGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152498.1-742s1c1
Sequence:CCGGGCTGATGACAAGATTGTCGTTCTCGAGAACGACAATCTTGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152498.1-1545s1c1
Sequence:CCGGCGGAGAGTGTTCCTTTAGCAACTCGAGTTGCTAAAGGAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks