EMAIL THIS PAGE TO A FRIEND

WDR66

WD repeat domain 66

UniProtKB ID: Q8TBY9, C9J1W2, Q8IYA3, Q8N898, Q8NDE7
Gene ID:
Human(144406) Summary: This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(269701) WD repeat domain 66
Rat(304498) WD repeat domain 66
domestic guinea pig(100714357) WD repeat domain 66
naked mole-rat(101705494) WD repeat domain 66
cow(536738) WD repeat domain 66
sheep(101103268) WD repeat domain 66
Zebrafish(569257) WD repeat domain 66
chicken(416855) WD repeat domain 66
Horse(100059883) WD repeat domain 66
domestic cat(101096173) WD repeat domain 66
dog(477466) WD repeat domain 66
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144668 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130701 MISSION® esiRNA esiRNA human WDR66 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144668 Rosetta Predictions human pricing
XM_001079344 Rosetta Predictions rat pricing
XM_222180 Rosetta Predictions rat pricing
XM_485681 Rosetta Predictions mouse pricing
XM_915421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222214 predicted 1654
2 SASI_Hs01_00222216 predicted 3033
3 SASI_Hs01_00222217 predicted 596
4 SASI_Hs01_00222218 predicted 2365
5 SASI_Hs02_00364557 predicted 1389
6 SASI_Hs01_00222220 predicted 2711
7 SASI_Hs02_00364558 predicted 2441
8 SASI_Hs02_00364559 predicted 3366
9 SASI_Hs02_00364560 predicted 3264
10 SASI_Hs02_00364561 predicted 1281
11 SASI_Hs01_00222212 predicted 1664
12 SASI_Hs01_00222213 predicted 3161
13 SASI_Hs01_00222215 predicted 3154
14 SASI_Hs01_00222219 predicted 1472
15 SASI_Hs01_00222221 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364078 predicted 2098
2 SASI_Rn02_00364079 predicted 1435
3 SASI_Rn02_00364080 predicted 1473
4 SASI_Rn02_00364081 predicted 790
5 SASI_Rn02_00364082 predicted 3169
6 SASI_Rn02_00364083 predicted 1971
7 SASI_Rn02_00364084 predicted 2611
8 SASI_Rn02_00364085 predicted 1507
9 SASI_Rn02_00364086 predicted 1871
10 SASI_Rn02_00364087 predicted 2118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380615 predicted 941
2 SASI_Rn02_00380616 predicted 2049
3 SASI_Rn02_00380617 predicted 280
4 SASI_Rn02_00380618 predicted 2029
5 SASI_Rn02_00380619 predicted 315
6 SASI_Rn02_00380620 predicted 2194
7 SASI_Rn02_00380621 predicted 811
8 SASI_Rn02_00380622 predicted 1459
9 SASI_Rn02_00380623 predicted 355
10 SASI_Rn02_00380624 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426676 predicted 1358
2 SASI_Mm02_00426677 predicted 1229
3 SASI_Mm02_00426678 predicted 1351
4 SASI_Mm02_00426679 predicted 3522
5 SASI_Mm02_00426680 predicted 3480
6 SASI_Mm02_00426681 predicted 3505
7 SASI_Mm02_00426682 predicted 1323
8 SASI_Mm02_00426683 predicted 3514
9 SASI_Mm02_00426684 predicted 1330
10 SASI_Mm02_00426685 predicted 3485
11 SASI_Mm01_00231225 predicted 2431
12 SASI_Mm01_00231226 predicted 1881
13 SASI_Mm01_00231227 predicted 2553
14 SASI_Mm01_00231228 predicted 2833
15 SASI_Mm01_00231229 predicted 2448
16 SASI_Mm01_00231230 predicted 1287
17 SASI_Mm01_00231231 predicted 3282
18 SASI_Mm01_00231232 predicted 2001
19 SASI_Mm01_00231233 predicted 2260
20 SASI_Mm01_00231234 predicted 2408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439417 predicted 1625
2 SASI_Mm02_00439418 predicted 420
3 SASI_Mm02_00439419 predicted 1740
4 SASI_Mm02_00439420 predicted 2025
5 SASI_Mm02_00439421 predicted 1643
6 SASI_Mm02_00439422 predicted 487
7 SASI_Mm02_00439423 predicted 2478
8 SASI_Mm02_00439424 predicted 1198
9 SASI_Mm02_00439425 predicted 1465
10 SASI_Mm02_00439426 predicted 1602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144668
WDR66 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 66
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144668.2-3613s1c1
Sequence:CCGGCCAGGAATGTTTAAAGCACAACTCGAGTTGTGCTTTAAACATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-3483s1c1
Sequence:CCGGGCTCCGTCAAAGGTTCAGAAACTCGAGTTTCTGAACCTTTGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-508s1c1
Sequence:CCGGCCAGTCAATCACATCAGGAATCTCGAGATTCCTGATGTGATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-3551s1c1
Sequence:CCGGGCGACTGAAATTCTTGGCTTACTCGAGTAAGCCAAGAATTTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-1622s1c1
Sequence:CCGGCCCTATATCAAGCCTTGTAAACTCGAGTTTACAAGGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144668.4-2220s21c1
Sequence:CCGGGAACCAGTGTGACTCATATAACTCGAGTTATATGAGTCACACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144668.4-1026s21c1
Sequence:CCGGTTCAGGGCCACGCCAATATTACTCGAGTAATATTGGCGTGGCCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144668
WDR66 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 66
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144668.2-3613s1c1
Sequence:CCGGCCAGGAATGTTTAAAGCACAACTCGAGTTGTGCTTTAAACATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-3483s1c1
Sequence:CCGGGCTCCGTCAAAGGTTCAGAAACTCGAGTTTCTGAACCTTTGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-508s1c1
Sequence:CCGGCCAGTCAATCACATCAGGAATCTCGAGATTCCTGATGTGATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-3551s1c1
Sequence:CCGGGCGACTGAAATTCTTGGCTTACTCGAGTAAGCCAAGAATTTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-1622s1c1
Sequence:CCGGCCCTATATCAAGCCTTGTAAACTCGAGTTTACAAGGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144668.4-2220s21c1
Sequence:CCGGGAACCAGTGTGACTCATATAACTCGAGTTATATGAGTCACACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144668.4-1026s21c1
Sequence:CCGGTTCAGGGCCACGCCAATATTACTCGAGTAATATTGGCGTGGCCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144668
WDR66 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 66
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144668.2-3613s1c1
Sequence:CCGGCCAGGAATGTTTAAAGCACAACTCGAGTTGTGCTTTAAACATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-3483s1c1
Sequence:CCGGGCTCCGTCAAAGGTTCAGAAACTCGAGTTTCTGAACCTTTGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-508s1c1
Sequence:CCGGCCAGTCAATCACATCAGGAATCTCGAGATTCCTGATGTGATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-3551s1c1
Sequence:CCGGGCGACTGAAATTCTTGGCTTACTCGAGTAAGCCAAGAATTTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144668.2-1622s1c1
Sequence:CCGGCCCTATATCAAGCCTTGTAAACTCGAGTTTACAAGGCTTGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144668.4-2220s21c1
Sequence:CCGGGAACCAGTGTGACTCATATAACTCGAGTTATATGAGTCACACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144668.4-1026s21c1
Sequence:CCGGTTCAGGGCCACGCCAATATTACTCGAGTAATATTGGCGTGGCCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks