EMAIL THIS PAGE TO A FRIEND

WDR6

WD repeat domain 6

UniProtKB ID: Q9NNW5, B4DHK2, Q3MIT1, Q9UF63
Gene ID:
Human(11180) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. The encoded protein interacts with serine/threonine kinase 11, and is implicated in cell growth arrest. [provided by RefSeq, Aug 2008]
Mouse(83669) WD repeat domain 6
Rat(301007) WD repeat domain 6
domestic guinea pig(100727147) WD repeat domain 6
naked mole-rat(101698003) WD repeat domain 6
cow(526884) WD repeat domain 6
sheep(101108523) WD repeat domain 6
Zebrafish(100004270) WD repeat domain 6
chicken(416060) WD repeat domain 6
Horse(100063394) WD repeat domain 6
domestic cat(101101370) WD repeat domain 6
dog(608948) WD repeat domain 6
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018031 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018031 Rosetta Predictions human pricing
NM_031392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092237 predicted 828
2 SASI_Hs01_00092238 predicted 2615
3 SASI_Hs01_00092239 predicted 1250
4 SASI_Hs01_00092240 predicted 2739
5 SASI_Hs02_00351141 predicted 1922
6 SASI_Hs01_00092242 predicted 3183
7 SASI_Hs01_00092243 predicted 2136
8 SASI_Hs01_00092244 predicted 450
9 SASI_Hs02_00351142 predicted 2766
10 SASI_Hs02_00351143 predicted 1366
11 SASI_Hs01_00092241 predicted 864
12 SASI_Hs01_00092245 predicted 1416
13 SASI_Hs01_00092246 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193910 predicted 3426
2 SASI_Mm02_00337139 predicted 2610
3 SASI_Mm01_00193911 predicted 2668
4 SASI_Mm01_00193914 predicted 1540
5 SASI_Mm01_00193915 predicted 2774
6 SASI_Mm01_00193916 predicted 1846
7 SASI_Mm02_00337140 predicted 1966
8 SASI_Mm01_00193917 predicted 2451
9 SASI_Mm01_00193918 predicted 1227
10 SASI_Mm01_00193919 predicted 3180
11 SASI_Mm01_00193912 predicted 2667
12 SASI_Mm01_00193913 predicted 2379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018031
VALIDATED
WDR6 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2772s21c1
Sequence:CCGGCAATCGGCATCGGATGGTTAACTCGAGTTAACCATCCGATGCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-4051s21c1
Sequence:CCGGTCCTTTGCCTTTACCCTATACCTCGAGGTATAGGGTAAAGGCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2348s21c1
Sequence:CCGGTAAAGCGTGTGGGCACCATTACTCGAGTAATGGTGCCCACACGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-368s21c1
Sequence:CCGGGTGGGCATCTGCGGATGATAACTCGAGTTATCATCCGCAGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2739s21c1
Sequence:CCGGCCACCGGCTAGATGAGTATTGCTCGAGCAATACTCATCTAGCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-406s1c1
Sequence:CCGGCGCTGGCTTGAGGGAAATATACTCGAGTATATTTCCCTCAAGCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018031.2-3667s1c1
Sequence:CCGGCTTTGTGAACATTCCCAGGTACTCGAGTACCTGGGAATGTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018031.2-3859s1c1
Sequence:CCGGGCTTCCTTTGCCTTTACCCTACTCGAGTAGGGTAAAGGCAAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-783s1c1
Sequence:CCGGGCAGAATATTGGGCACTGCTTCTCGAGAAGCAGTGCCCAATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-454s1c1
Sequence:CCGGGTGCTATATGACCCTGTAGTACTCGAGTACTACAGGGTCATATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018031.2-1188s1c1
Sequence:CCGGGCTGCTAGAGGATAAACATTTCTCGAGAAATGTTTATCCTCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018031
VALIDATED
WDR6 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2772s21c1
Sequence:CCGGCAATCGGCATCGGATGGTTAACTCGAGTTAACCATCCGATGCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-4051s21c1
Sequence:CCGGTCCTTTGCCTTTACCCTATACCTCGAGGTATAGGGTAAAGGCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2348s21c1
Sequence:CCGGTAAAGCGTGTGGGCACCATTACTCGAGTAATGGTGCCCACACGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-368s21c1
Sequence:CCGGGTGGGCATCTGCGGATGATAACTCGAGTTATCATCCGCAGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2739s21c1
Sequence:CCGGCCACCGGCTAGATGAGTATTGCTCGAGCAATACTCATCTAGCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-406s1c1
Sequence:CCGGCGCTGGCTTGAGGGAAATATACTCGAGTATATTTCCCTCAAGCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018031.2-3667s1c1
Sequence:CCGGCTTTGTGAACATTCCCAGGTACTCGAGTACCTGGGAATGTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018031.2-3859s1c1
Sequence:CCGGGCTTCCTTTGCCTTTACCCTACTCGAGTAGGGTAAAGGCAAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-783s1c1
Sequence:CCGGGCAGAATATTGGGCACTGCTTCTCGAGAAGCAGTGCCCAATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-454s1c1
Sequence:CCGGGTGCTATATGACCCTGTAGTACTCGAGTACTACAGGGTCATATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018031.2-1188s1c1
Sequence:CCGGGCTGCTAGAGGATAAACATTTCTCGAGAAATGTTTATCCTCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018031
VALIDATED
WDR6 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2772s21c1
Sequence:CCGGCAATCGGCATCGGATGGTTAACTCGAGTTAACCATCCGATGCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-4051s21c1
Sequence:CCGGTCCTTTGCCTTTACCCTATACCTCGAGGTATAGGGTAAAGGCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2348s21c1
Sequence:CCGGTAAAGCGTGTGGGCACCATTACTCGAGTAATGGTGCCCACACGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-368s21c1
Sequence:CCGGGTGGGCATCTGCGGATGATAACTCGAGTTATCATCCGCAGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018031.3-2739s21c1
Sequence:CCGGCCACCGGCTAGATGAGTATTGCTCGAGCAATACTCATCTAGCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-406s1c1
Sequence:CCGGCGCTGGCTTGAGGGAAATATACTCGAGTATATTTCCCTCAAGCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018031.2-3667s1c1
Sequence:CCGGCTTTGTGAACATTCCCAGGTACTCGAGTACCTGGGAATGTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018031.2-3859s1c1
Sequence:CCGGGCTTCCTTTGCCTTTACCCTACTCGAGTAGGGTAAAGGCAAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-783s1c1
Sequence:CCGGGCAGAATATTGGGCACTGCTTCTCGAGAAGCAGTGCCCAATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018031.2-454s1c1
Sequence:CCGGGTGCTATATGACCCTGTAGTACTCGAGTACTACAGGGTCATATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018031.2-1188s1c1
Sequence:CCGGGCTGCTAGAGGATAAACATTTCTCGAGAAATGTTTATCCTCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031392
VALIDATED
WDR6 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-1806s21c1
Sequence:CCGGTGCCATGGTGGCTACCTATACCTCGAGGTATAGGTAGCCACCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-3562s21c1
Sequence:CCGGACCATAGTTCTCGCAAGTATTCTCGAGAATACTTGCGAGAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-1236s21c1
Sequence:CCGGGACAATCGCTTTCGGTCTTACCTCGAGGTAAGACCGAAAGCGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-3022s21c1
Sequence:CCGGCCCATAGCTGTGGCGTCAATACTCGAGTATTGACGCCACAGCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031392.2-1489s21c1
Sequence:CCGGCCACTGGCAAGGCTATCTTTGCTCGAGCAAAGATAGCCTTGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031392.2-3944s1c1
Sequence:CCGGCCCTAGAATATGTACTCGGTTCTCGAGAACCGAGTACATATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031392.2-3429s1c1
Sequence:CCGGCTTGAGGTTTACAACTGGTATCTCGAGATACCAGTTGTAAACCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031392.2-2085s1c1
Sequence:CCGGGCCTTTACCTACCTGAAGGATCTCGAGATCCTTCAGGTAGGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031392
VALIDATED
WDR6 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-1806s21c1
Sequence:CCGGTGCCATGGTGGCTACCTATACCTCGAGGTATAGGTAGCCACCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-3562s21c1
Sequence:CCGGACCATAGTTCTCGCAAGTATTCTCGAGAATACTTGCGAGAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-1236s21c1
Sequence:CCGGGACAATCGCTTTCGGTCTTACCTCGAGGTAAGACCGAAAGCGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-3022s21c1
Sequence:CCGGCCCATAGCTGTGGCGTCAATACTCGAGTATTGACGCCACAGCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031392.2-1489s21c1
Sequence:CCGGCCACTGGCAAGGCTATCTTTGCTCGAGCAAAGATAGCCTTGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031392.2-3944s1c1
Sequence:CCGGCCCTAGAATATGTACTCGGTTCTCGAGAACCGAGTACATATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031392.2-3429s1c1
Sequence:CCGGCTTGAGGTTTACAACTGGTATCTCGAGATACCAGTTGTAAACCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031392.2-2085s1c1
Sequence:CCGGGCCTTTACCTACCTGAAGGATCTCGAGATCCTTCAGGTAGGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031392
VALIDATED
WDR6 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-1806s21c1
Sequence:CCGGTGCCATGGTGGCTACCTATACCTCGAGGTATAGGTAGCCACCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-3562s21c1
Sequence:CCGGACCATAGTTCTCGCAAGTATTCTCGAGAATACTTGCGAGAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-1236s21c1
Sequence:CCGGGACAATCGCTTTCGGTCTTACCTCGAGGTAAGACCGAAAGCGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031392.2-3022s21c1
Sequence:CCGGCCCATAGCTGTGGCGTCAATACTCGAGTATTGACGCCACAGCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031392.2-1489s21c1
Sequence:CCGGCCACTGGCAAGGCTATCTTTGCTCGAGCAAAGATAGCCTTGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031392.2-3944s1c1
Sequence:CCGGCCCTAGAATATGTACTCGGTTCTCGAGAACCGAGTACATATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031392.2-3429s1c1
Sequence:CCGGCTTGAGGTTTACAACTGGTATCTCGAGATACCAGTTGTAAACCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031392.2-2085s1c1
Sequence:CCGGGCCTTTACCTACCTGAAGGATCTCGAGATCCTTCAGGTAGGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks