EMAIL THIS PAGE TO A FRIEND

WDR70

WD repeat domain 70

UniProtKB ID: Q9NW82, Q9H053
Gene ID:
Mouse(545085) WD repeat domain 70
Rat(294783) WD repeat domain 70
naked mole-rat(101701259) WD repeat domain 70
Domestic Rabbit(100348233) WD repeat domain 70
domestic guinea pig(100735925) WD repeat domain 70
cow(540724) WD repeat domain 70
sheep(101107551) WD repeat domain 70
chicken(427444) WD repeat domain 70
domestic cat(101098117) WD repeat domain 70
Horse(100053352) WD repeat domain 70
dog(489225) WD repeat domain 70
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018034 Rosetta Predictions human pricing
NM_001013909 Rosetta Predictions rat pricing
NM_001081402 Rosetta Predictions mouse pricing
XM_978536 Rosetta Predictions mouse pricing
XM_978582 Rosetta Predictions mouse pricing
XM_978614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191656 predicted 1852
2 SASI_Hs01_00191657 predicted 1517
3 SASI_Hs01_00191658 predicted 1195
4 SASI_Hs01_00191659 predicted 1804
5 SASI_Hs01_00191660 predicted 1459
6 SASI_Hs01_00191661 predicted 1178
7 SASI_Hs01_00191664 predicted 1149
8 SASI_Hs01_00191665 predicted 1427
9 SASI_Hs02_00351146 predicted 1524
10 SASI_Hs02_00351147 predicted 1180
11 SASI_Hs01_00191662 predicted 1278
12 SASI_Hs01_00191663 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045310 predicted 1315
2 SASI_Rn01_00045311 predicted 1272
3 SASI_Rn01_00045312 predicted 511
4 SASI_Rn01_00045313 predicted 1006
5 SASI_Rn01_00045314 predicted 1580
6 SASI_Rn01_00045315 predicted 615
7 SASI_Rn02_00201196 predicted 1769
8 SASI_Rn01_00045316 predicted 1297
9 SASI_Rn01_00045317 predicted 1399
10 SASI_Rn01_00045319 predicted 1361
11 SASI_Rn01_00045318 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298041 predicted 1165
2 SASI_Mm02_00298042 predicted 674
3 SASI_Mm02_00298043 predicted 1637
4 SASI_Mm02_00298044 predicted 658
5 SASI_Mm02_00298045 predicted 1375
6 SASI_Mm02_00298046 predicted 486
7 SASI_Mm02_00298047 predicted 1465
8 SASI_Mm02_00298048 predicted 1385
9 SASI_Mm02_00298049 predicted 569
10 SASI_Mm02_00298050 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248773 predicted 850
2 SASI_Mm01_00248774 predicted 813
3 SASI_Mm01_00248775 predicted 850
4 SASI_Mm01_00248776 predicted 856
5 SASI_Mm01_00248777 predicted 846
6 SASI_Mm01_00248778 predicted 725
7 SASI_Mm01_00248779 predicted 855
8 SASI_Mm01_00248780 predicted 814
9 SASI_Mm01_00248781 predicted 823
10 SASI_Mm01_00248782 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217838 predicted 1168
2 SASI_Mm01_00217839 predicted 677
3 SASI_Mm01_00217840 predicted 1647
4 SASI_Mm01_00217841 predicted 663
5 SASI_Mm01_00217842 predicted 1380
6 SASI_Mm01_00217843 predicted 489
7 SASI_Mm01_00217844 predicted 1462
8 SASI_Mm01_00217845 predicted 1385
9 SASI_Mm01_00217846 predicted 580
10 SASI_Mm01_00217847 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227678 predicted 338
2 SASI_Mm01_00227679 predicted 274
3 SASI_Mm01_00227680 predicted 834
4 SASI_Mm01_00227681 predicted 303
5 SASI_Mm01_00227682 predicted 287
6 SASI_Mm01_00227683 predicted 807
7 SASI_Mm01_00227684 predicted 351
8 SASI_Mm01_00227685 predicted 388
9 SASI_Mm01_00227686 predicted 521
10 SASI_Mm01_00227687 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018034
VALIDATED
WDR70 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 70
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-1460s1c1
Sequence:CCGGGACATCACAGATGCGAGTGTTCTCGAGAACACTCGCATCTGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018034.2-1380s1c1
Sequence:CCGGGTACATCTATTCAAAGAGGATCTCGAGATCCTCTTTGAATAGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018034.2-2025s1c1
Sequence:CCGGGAATCTCATTTGAGAGCTGTTCTCGAGAACAGCTCTCAAATGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-339s1c1
Sequence:CCGGCCAAATCATCTTCCAGGGATACTCGAGTATCCCTGGAAGATGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018034.2-2029s1c1
Sequence:CCGGCTCATTTGAGAGCTGTTTGCACTCGAGTGCAAACAGCTCTCAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-1495s1c1
Sequence:CCGGGCATCCAAAGCTGAACCAGATCTCGAGATCTGGTTCAGCTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018034
VALIDATED
WDR70 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 70
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-1460s1c1
Sequence:CCGGGACATCACAGATGCGAGTGTTCTCGAGAACACTCGCATCTGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018034.2-1380s1c1
Sequence:CCGGGTACATCTATTCAAAGAGGATCTCGAGATCCTCTTTGAATAGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018034.2-2025s1c1
Sequence:CCGGGAATCTCATTTGAGAGCTGTTCTCGAGAACAGCTCTCAAATGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-339s1c1
Sequence:CCGGCCAAATCATCTTCCAGGGATACTCGAGTATCCCTGGAAGATGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018034.2-2029s1c1
Sequence:CCGGCTCATTTGAGAGCTGTTTGCACTCGAGTGCAAACAGCTCTCAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-1495s1c1
Sequence:CCGGGCATCCAAAGCTGAACCAGATCTCGAGATCTGGTTCAGCTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018034
VALIDATED
WDR70 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 70
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-1460s1c1
Sequence:CCGGGACATCACAGATGCGAGTGTTCTCGAGAACACTCGCATCTGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018034.2-1380s1c1
Sequence:CCGGGTACATCTATTCAAAGAGGATCTCGAGATCCTCTTTGAATAGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018034.2-2025s1c1
Sequence:CCGGGAATCTCATTTGAGAGCTGTTCTCGAGAACAGCTCTCAAATGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-339s1c1
Sequence:CCGGCCAAATCATCTTCCAGGGATACTCGAGTATCCCTGGAAGATGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018034.2-2029s1c1
Sequence:CCGGCTCATTTGAGAGCTGTTTGCACTCGAGTGCAAACAGCTCTCAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018034.2-1495s1c1
Sequence:CCGGGCATCCAAAGCTGAACCAGATCTCGAGATCTGGTTCAGCTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081402
VALIDATED
WDR70 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 70
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000255050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1285s21c1
Sequence:CCGGTTATGGGATGTCCGGCAATTTCTCGAGAAATTGCCGGACATCCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-675s21c1
Sequence:CCGGAGGATATGATTACGATGTTAACTCGAGTTAACATCGTAATCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1261s21c1
Sequence:CCGGCGTGGAGGCGATGATACATTACTCGAGTAATGTATCATCGCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1160s21c1
Sequence:CCGGACCTGACAGTTCACCCTAAATCTCGAGATTTAGGGTGAACTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081402
VALIDATED
WDR70 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 70
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000255050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1285s21c1
Sequence:CCGGTTATGGGATGTCCGGCAATTTCTCGAGAAATTGCCGGACATCCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-675s21c1
Sequence:CCGGAGGATATGATTACGATGTTAACTCGAGTTAACATCGTAATCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1261s21c1
Sequence:CCGGCGTGGAGGCGATGATACATTACTCGAGTAATGTATCATCGCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1160s21c1
Sequence:CCGGACCTGACAGTTCACCCTAAATCTCGAGATTTAGGGTGAACTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081402
VALIDATED
WDR70 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 70
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000255050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1285s21c1
Sequence:CCGGTTATGGGATGTCCGGCAATTTCTCGAGAAATTGCCGGACATCCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-675s21c1
Sequence:CCGGAGGATATGATTACGATGTTAACTCGAGTTAACATCGTAATCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1261s21c1
Sequence:CCGGCGTGGAGGCGATGATACATTACTCGAGTAATGTATCATCGCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081402.1-1160s21c1
Sequence:CCGGACCTGACAGTTCACCCTAAATCTCGAGATTTAGGGTGAACTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks