EMAIL THIS PAGE TO A FRIEND

WDR72

WD repeat domain 72

Synonyms: AI2A3
UniProtKB ID: Q3MJ13, Q7Z3I3, Q8N8X2
Gene ID:
Human(256764) Summary: This gene encodes a protein with eight WD-40 repeats. Mutations in this gene have been associated with amelogenesis imperfecta hypomaturation type 2A3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Mouse(546144) WD repeat domain 72
Rat(300834) WD repeat domain 72
chicken(427497) WD repeat domain 72
Horse(100069384) WD repeat domain 72
domestic cat(101091700) WD repeat domain 72
dog(487562) WD repeat domain 72
cow(525892) WD repeat domain 72
sheep(101101895) WD repeat domain 72
domestic guinea pig(101787299) WD repeat domain 72
Domestic Rabbit(100353113) WD repeat domain 72
naked mole-rat(101723150) WD repeat domain 72
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182758 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182758 Rosetta Predictions human pricing
XM_001057115 Rosetta Predictions rat pricing
XM_236408 Rosetta Predictions rat pricing
NM_001033500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370916 predicted 706
2 SASI_Hs01_00129828 predicted 3449
3 SASI_Hs01_00129829 predicted 2481
4 SASI_Hs01_00129830 predicted 2602
5 SASI_Hs01_00129831 predicted 1467
6 SASI_Hs02_00370917 predicted 716
7 SASI_Hs01_00129832 predicted 889
8 SASI_Hs01_00129833 predicted 1110
9 SASI_Hs01_00129834 predicted 906
10 SASI_Hs01_00129835 predicted 201
11 SASI_Hs01_00129826 predicted 612
12 SASI_Hs01_00129827 predicted 3346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285469 predicted 2166
2 SASI_Rn02_00285470 predicted 2741
3 SASI_Rn02_00285471 predicted 573
4 SASI_Rn02_00285472 predicted 1463
5 SASI_Rn02_00285473 predicted 974
6 SASI_Rn02_00285474 predicted 816
7 SASI_Rn02_00285475 predicted 1743
8 SASI_Rn02_00285476 predicted 1170
9 SASI_Rn02_00285477 predicted 2386
10 SASI_Rn02_00285478 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390039 predicted 2168
2 SASI_Rn02_00390040 predicted 2746
3 SASI_Rn02_00390041 predicted 565
4 SASI_Rn02_00390042 predicted 1459
5 SASI_Rn02_00390043 predicted 975
6 SASI_Rn02_00390044 predicted 811
7 SASI_Rn02_00390045 predicted 1744
8 SASI_Rn02_00390046 predicted 1172
9 SASI_Rn02_00390047 predicted 2389
10 SASI_Rn02_00390048 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288869 predicted 1334
2 SASI_Mm02_00288870 predicted 2161
3 SASI_Mm02_00288871 predicted 1100
4 SASI_Mm02_00288872 predicted 1646
5 SASI_Mm02_00288873 predicted 825
6 SASI_Mm02_00288874 predicted 3113
7 SASI_Mm02_00288875 predicted 1884
8 SASI_Mm02_00288876 predicted 3508
9 SASI_Mm02_00288877 predicted 1953
10 SASI_Mm02_00288878 predicted 1639
11 SASI_Mm01_00104752 predicted 636
12 SASI_Mm01_00104753 predicted 639
13 SASI_Mm01_00104754 predicted 428
14 SASI_Mm01_00104755 predicted 517
15 SASI_Mm01_00104756 predicted 647
16 SASI_Mm01_00104757 predicted 608
17 SASI_Mm01_00104758 predicted 471
18 SASI_Mm01_00104759 predicted 514
19 SASI_Mm01_00104760 predicted 590
20 SASI_Mm01_00104761 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182758
WDR72 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 72
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182758.2-3436s21c1
Sequence:CCGGGTTGTTATTGGTCAAGTTATTCTCGAGAATAACTTGACCAATAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182758.2-3803s21c1
Sequence:CCGGATTTGTCTGGTTAGGATATTTCTCGAGAAATATCCTAACCAGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-2376s1c1
Sequence:CCGGGCAGCCTAAGCCATCAAGAAACTCGAGTTTCTTGATGGCTTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-1895s1c1
Sequence:CCGGCCATTGCCTCAGAGACACTTACTCGAGTAAGTGTCTCTGAGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-202s1c1
Sequence:CCGGGCGAAAGAACTCCTATTTGGTCTCGAGACCAAATAGGAGTTCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-2898s1c1
Sequence:CCGGCAGTTGCTTACGAAATGGTAACTCGAGTTACCATTTCGTAAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-3306s1c1
Sequence:CCGGGCATCATTCATGGATAGCAAACTCGAGTTTGCTATCCATGAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182758.1-309s1c1
Sequence:CCGGGTGTGTTTGGAATGTCACCAACTCGAGTTGGTGACATTCCAAACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182758
WDR72 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 72
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182758.2-3436s21c1
Sequence:CCGGGTTGTTATTGGTCAAGTTATTCTCGAGAATAACTTGACCAATAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182758.2-3803s21c1
Sequence:CCGGATTTGTCTGGTTAGGATATTTCTCGAGAAATATCCTAACCAGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-2376s1c1
Sequence:CCGGGCAGCCTAAGCCATCAAGAAACTCGAGTTTCTTGATGGCTTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-1895s1c1
Sequence:CCGGCCATTGCCTCAGAGACACTTACTCGAGTAAGTGTCTCTGAGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-202s1c1
Sequence:CCGGGCGAAAGAACTCCTATTTGGTCTCGAGACCAAATAGGAGTTCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-2898s1c1
Sequence:CCGGCAGTTGCTTACGAAATGGTAACTCGAGTTACCATTTCGTAAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-3306s1c1
Sequence:CCGGGCATCATTCATGGATAGCAAACTCGAGTTTGCTATCCATGAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182758.1-309s1c1
Sequence:CCGGGTGTGTTTGGAATGTCACCAACTCGAGTTGGTGACATTCCAAACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182758
WDR72 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 72
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182758.2-3436s21c1
Sequence:CCGGGTTGTTATTGGTCAAGTTATTCTCGAGAATAACTTGACCAATAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182758.2-3803s21c1
Sequence:CCGGATTTGTCTGGTTAGGATATTTCTCGAGAAATATCCTAACCAGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-2376s1c1
Sequence:CCGGGCAGCCTAAGCCATCAAGAAACTCGAGTTTCTTGATGGCTTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-1895s1c1
Sequence:CCGGCCATTGCCTCAGAGACACTTACTCGAGTAAGTGTCTCTGAGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-202s1c1
Sequence:CCGGGCGAAAGAACTCCTATTTGGTCTCGAGACCAAATAGGAGTTCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-2898s1c1
Sequence:CCGGCAGTTGCTTACGAAATGGTAACTCGAGTTACCATTTCGTAAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182758.1-3306s1c1
Sequence:CCGGGCATCATTCATGGATAGCAAACTCGAGTTTGCTATCCATGAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182758.1-309s1c1
Sequence:CCGGGTGTGTTTGGAATGTCACCAACTCGAGTTGGTGACATTCCAAACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033500
WDR72 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 72
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-1518s21c1
Sequence:CCGGCCCTAGAGAAATACCAATAACCTCGAGGTTATTGGTATTTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033500.3-3838s21c1
Sequence:CCGGCTGTAGCAGATTCGCTAATATCTCGAGATATTAGCGAATCTGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-2879s21c1
Sequence:CCGGCCAGGCATCTCAGTATCTTAACTCGAGTTAAGATACTGAGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-1097s21c1
Sequence:CCGGGTTGGAAGATTTATGACTATTCTCGAGAATAGTCATAAATCTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-2802s21c1
Sequence:CCGGCACAATAGACATGGCGAAATTCTCGAGAATTTCGCCATGTCTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033500
WDR72 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 72
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-1518s21c1
Sequence:CCGGCCCTAGAGAAATACCAATAACCTCGAGGTTATTGGTATTTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033500.3-3838s21c1
Sequence:CCGGCTGTAGCAGATTCGCTAATATCTCGAGATATTAGCGAATCTGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-2879s21c1
Sequence:CCGGCCAGGCATCTCAGTATCTTAACTCGAGTTAAGATACTGAGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-1097s21c1
Sequence:CCGGGTTGGAAGATTTATGACTATTCTCGAGAATAGTCATAAATCTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-2802s21c1
Sequence:CCGGCACAATAGACATGGCGAAATTCTCGAGAATTTCGCCATGTCTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033500
WDR72 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 72
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-1518s21c1
Sequence:CCGGCCCTAGAGAAATACCAATAACCTCGAGGTTATTGGTATTTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033500.3-3838s21c1
Sequence:CCGGCTGTAGCAGATTCGCTAATATCTCGAGATATTAGCGAATCTGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-2879s21c1
Sequence:CCGGCCAGGCATCTCAGTATCTTAACTCGAGTTAAGATACTGAGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-1097s21c1
Sequence:CCGGGTTGGAAGATTTATGACTATTCTCGAGAATAGTCATAAATCTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033500.3-2802s21c1
Sequence:CCGGCACAATAGACATGGCGAAATTCTCGAGAATTTCGCCATGTCTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks