EMAIL THIS PAGE TO A FRIEND

WDR73

WD repeat domain 73

UniProtKB ID: Q6P4I2, Q96JZ1, Q9P0B7
Gene ID:
Mouse(71968) WD repeat domain 73
Rat(308751) WD repeat domain 73
naked mole-rat(101721374) WD repeat domain 73
domestic guinea pig(100727524) WD repeat domain 73
cow(783802) WD repeat domain 73
sheep(101108342) WD repeat domain 73
Zebrafish(550339) WD repeat domain 73
Horse(100068587) WD repeat domain 73
domestic cat(101087067) WD repeat domain 73
dog(609576) WD repeat domain 73
chicken(425698) WD repeat domain 73
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032856 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032856 Rosetta Predictions human pricing
NM_001107525 Rosetta Predictions rat pricing
XM_001479473 Rosetta Predictions mouse pricing
XM_001479496 Rosetta Predictions mouse pricing
XM_889711 Rosetta Predictions mouse pricing
XM_981607 Rosetta Predictions mouse pricing
XM_981644 Rosetta Predictions mouse pricing
XM_981681 Rosetta Predictions mouse pricing
XM_981744 Rosetta Predictions mouse pricing
XM_981778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036096 predicted 292
2 SASI_Hs01_00036097 predicted 381
3 SASI_Hs01_00036098 predicted 265
4 SASI_Hs01_00036099 predicted 923
5 SASI_Hs01_00036100 predicted 264
6 SASI_Hs01_00036101 predicted 937
7 SASI_Hs01_00036102 predicted 629
8 SASI_Hs01_00036104 predicted 257
9 SASI_Hs02_00360453 predicted 346
10 SASI_Hs01_00036105 predicted 517
11 SASI_Hs01_00036103 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229685 predicted 777
2 SASI_Rn02_00229686 predicted 940
3 SASI_Rn02_00229687 predicted 414
4 SASI_Rn02_00229688 predicted 1118
5 SASI_Rn02_00229689 predicted 957
6 SASI_Rn02_00229690 predicted 813
7 SASI_Rn02_00229691 predicted 654
8 SASI_Rn02_00229692 predicted 924
9 SASI_Rn02_00229693 predicted 405
10 SASI_Rn02_00229694 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410224 predicted 1105
2 SASI_Mm02_00410225 predicted 1010
3 SASI_Mm02_00410226 predicted 1181
4 SASI_Mm02_00410227 predicted 939
5 SASI_Mm02_00410228 predicted 413
6 SASI_Mm02_00410229 predicted 530
7 SASI_Mm02_00410230 predicted 930
8 SASI_Mm02_00410231 predicted 1002
9 SASI_Mm02_00410232 predicted 1190
10 SASI_Mm02_00410233 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410415 predicted 898
2 SASI_Mm02_00410416 predicted 937
3 SASI_Mm02_00410417 predicted 416
4 SASI_Mm02_00410418 predicted 535
5 SASI_Mm02_00410419 predicted 656
6 SASI_Mm02_00410420 predicted 569
7 SASI_Mm02_00410421 predicted 758
8 SASI_Mm02_00410422 predicted 997
9 SASI_Mm02_00410423 predicted 821
10 SASI_Mm02_00410424 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203372 predicted 1014
2 SASI_Mm01_00203373 predicted 653
3 SASI_Mm01_00203374 predicted 864
4 SASI_Mm01_00203375 predicted 953
5 SASI_Mm01_00203376 predicted 858
6 SASI_Mm01_00203377 predicted 999
7 SASI_Mm01_00203378 predicted 663
8 SASI_Mm01_00203379 predicted 712
9 SASI_Mm01_00203380 predicted 816
10 SASI_Mm01_00203381 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237299 predicted 470
2 SASI_Mm01_00237300 predicted 414
3 SASI_Mm01_00237301 predicted 473
4 SASI_Mm01_00237302 predicted 486
5 SASI_Mm01_00237303 predicted 415
6 SASI_Mm01_00237304 predicted 544
7 SASI_Mm01_00237305 predicted 446
8 SASI_Mm01_00237306 predicted 479
9 SASI_Mm01_00237307 predicted 583
10 SASI_Mm01_00237308 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260326 predicted 513
2 SASI_Mm01_00260327 predicted 356
3 SASI_Mm01_00260328 predicted 451
4 SASI_Mm01_00260329 predicted 519
5 SASI_Mm01_00260330 predicted 330
6 SASI_Mm01_00260331 predicted 451
7 SASI_Mm01_00260332 predicted 578
8 SASI_Mm01_00260333 predicted 487
9 SASI_Mm01_00260334 predicted 328
10 SASI_Mm01_00260335 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228259 predicted 590
2 SASI_Mm01_00228260 predicted 432
3 SASI_Mm01_00228261 predicted 531
4 SASI_Mm01_00228262 predicted 602
5 SASI_Mm01_00228263 predicted 413
6 SASI_Mm01_00228264 predicted 534
7 SASI_Mm01_00228265 predicted 654
8 SASI_Mm01_00228266 predicted 565
9 SASI_Mm01_00228267 predicted 400
10 SASI_Mm01_00228268 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274998 predicted 943
2 SASI_Mm01_00274999 predicted 880
3 SASI_Mm01_00275000 predicted 939
4 SASI_Mm01_00275001 predicted 949
5 SASI_Mm01_00275002 predicted 892
6 SASI_Mm01_00275003 predicted 1013
7 SASI_Mm01_00275004 predicted 919
8 SASI_Mm01_00275005 predicted 951
9 SASI_Mm01_00275006 predicted 1048
10 SASI_Mm01_00275007 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253851 predicted 145
2 SASI_Mm01_00253852 predicted 840
3 SASI_Mm01_00253853 predicted 283
4 SASI_Mm01_00253854 predicted 1136
5 SASI_Mm01_00253855 predicted 1045
6 SASI_Mm01_00253856 predicted 322
7 SASI_Mm01_00253857 predicted 1039
8 SASI_Mm01_00253858 predicted 537
9 SASI_Mm01_00253859 predicted 407
10 SASI_Mm01_00253860 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032856
VALIDATED
WDR73 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 73
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032856.1-864s1c1
Sequence:CCGGCCTGAAGAATTGCTTGGCCATCTCGAGATGGCCAAGCAATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032856.1-284s1c1
Sequence:CCGGCACATACCAGATTGCTGGTTACTCGAGTAACCAGCAATCTGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032856.1-1339s1c1
Sequence:CCGGCGAAGGTTAGAAGAAACGCATCTCGAGATGCGTTTCTTCTAACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032856.1-1326s1c1
Sequence:CCGGCGTAGTGATATTGCGAAGGTTCTCGAGAACCTTCGCAATATCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-1349s21c1
Sequence:CCGGCGAAGGTTAGAAGAAACGCATCTCGAGATGCGTTTCTTCTAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-266s21c1
Sequence:CCGGAGGTCTATCTTTGATCTAAAGCTCGAGCTTTAGATCAAAGATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-317s21c1
Sequence:CCGGAGTGGCCTTCCAGGTTGTTATCTCGAGATAACAACCTGGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-906s21c1
Sequence:CCGGATGGTACAGTCCAGGTCTATGCTCGAGCATAGACCTGGACTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-359s21c1
Sequence:CCGGGAGGACAGTGATGTCATTAAACTCGAGTTTAATGACATCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032856
VALIDATED
WDR73 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 73
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032856.1-864s1c1
Sequence:CCGGCCTGAAGAATTGCTTGGCCATCTCGAGATGGCCAAGCAATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032856.1-284s1c1
Sequence:CCGGCACATACCAGATTGCTGGTTACTCGAGTAACCAGCAATCTGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032856.1-1339s1c1
Sequence:CCGGCGAAGGTTAGAAGAAACGCATCTCGAGATGCGTTTCTTCTAACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032856.1-1326s1c1
Sequence:CCGGCGTAGTGATATTGCGAAGGTTCTCGAGAACCTTCGCAATATCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-1349s21c1
Sequence:CCGGCGAAGGTTAGAAGAAACGCATCTCGAGATGCGTTTCTTCTAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-266s21c1
Sequence:CCGGAGGTCTATCTTTGATCTAAAGCTCGAGCTTTAGATCAAAGATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-317s21c1
Sequence:CCGGAGTGGCCTTCCAGGTTGTTATCTCGAGATAACAACCTGGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-906s21c1
Sequence:CCGGATGGTACAGTCCAGGTCTATGCTCGAGCATAGACCTGGACTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-359s21c1
Sequence:CCGGGAGGACAGTGATGTCATTAAACTCGAGTTTAATGACATCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032856
VALIDATED
WDR73 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 73
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032856.1-864s1c1
Sequence:CCGGCCTGAAGAATTGCTTGGCCATCTCGAGATGGCCAAGCAATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032856.1-284s1c1
Sequence:CCGGCACATACCAGATTGCTGGTTACTCGAGTAACCAGCAATCTGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032856.1-1339s1c1
Sequence:CCGGCGAAGGTTAGAAGAAACGCATCTCGAGATGCGTTTCTTCTAACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032856.1-1326s1c1
Sequence:CCGGCGTAGTGATATTGCGAAGGTTCTCGAGAACCTTCGCAATATCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-1349s21c1
Sequence:CCGGCGAAGGTTAGAAGAAACGCATCTCGAGATGCGTTTCTTCTAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-266s21c1
Sequence:CCGGAGGTCTATCTTTGATCTAAAGCTCGAGCTTTAGATCAAAGATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-317s21c1
Sequence:CCGGAGTGGCCTTCCAGGTTGTTATCTCGAGATAACAACCTGGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-906s21c1
Sequence:CCGGATGGTACAGTCCAGGTCTATGCTCGAGCATAGACCTGGACTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032856.2-359s21c1
Sequence:CCGGGAGGACAGTGATGTCATTAAACTCGAGTTTAATGACATCACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028026
VALIDATED
WDR73 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 73
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000364020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028026.2-1077s21c1
Sequence:CCGGCCTCGCAAACCCAGAACTTTGCTCGAGCAAAGTTCTGGGTTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028026.2-1537s21c1
Sequence:CCGGCGATGTCTCAGGGCCAATAAACTCGAGTTTATTGGCCCTGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028026.2-592s21c1
Sequence:CCGGTTCAGGTCCTAGACGCAAATACTCGAGTATTTGCGTCTAGGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028026
VALIDATED
WDR73 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 73
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000364020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028026.2-1077s21c1
Sequence:CCGGCCTCGCAAACCCAGAACTTTGCTCGAGCAAAGTTCTGGGTTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028026.2-1537s21c1
Sequence:CCGGCGATGTCTCAGGGCCAATAAACTCGAGTTTATTGGCCCTGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028026.2-592s21c1
Sequence:CCGGTTCAGGTCCTAGACGCAAATACTCGAGTATTTGCGTCTAGGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028026
VALIDATED
WDR73 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 73
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000364020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028026.2-1077s21c1
Sequence:CCGGCCTCGCAAACCCAGAACTTTGCTCGAGCAAAGTTCTGGGTTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028026.2-1537s21c1
Sequence:CCGGCGATGTCTCAGGGCCAATAAACTCGAGTTTATTGGCCCTGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028026.2-592s21c1
Sequence:CCGGTTCAGGTCCTAGACGCAAATACTCGAGTATTTGCGTCTAGGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks