EMAIL THIS PAGE TO A FRIEND

WDR74

WD repeat domain 74

UniProtKB ID: Q6RFH5, A8K8G5, Q9BRC9, Q9H6X8, Q9NVY2
Gene ID:
Mouse(107071) WD repeat domain 74
Rat(690229) WD repeat domain 74
Zebrafish(558996) WD repeat domain 74
chicken(100858621) WD repeat domain 74
domestic cat(101093142) WD repeat domain 74
dog(483778) WD repeat domain 74
cow(505875) WD repeat domain 74
sheep(101116102) WD repeat domain 74
domestic guinea pig(100732282) WD repeat domain 74
naked mole-rat(101700576) WD repeat domain 74
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018093 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076941 MISSION® esiRNA esiRNA human WDR74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018093 Rosetta Predictions human pricing
NM_001109569 Rosetta Predictions rat pricing
NM_134139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159952 predicted 1074
2 SASI_Hs01_00159953 predicted 672
3 SASI_Hs01_00159955 predicted 784
4 SASI_Hs01_00159957 predicted 392
5 SASI_Hs02_00351274 predicted 710
6 SASI_Hs02_00351275 predicted 486
7 SASI_Hs01_00159958 predicted 861
8 SASI_Hs01_00159959 predicted 595
9 SASI_Hs01_00159960 predicted 836
10 SASI_Hs02_00351276 predicted 652
11 SASI_Hs01_00159954 predicted 1093
12 SASI_Hs01_00159956 predicted 1033
13 SASI_Hs01_00159961 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249681 predicted 478
2 SASI_Rn02_00249682 predicted 808
3 SASI_Rn02_00249683 predicted 575
4 SASI_Rn02_00249684 predicted 723
5 SASI_Rn02_00249685 predicted 456
6 SASI_Rn02_00249686 predicted 743
7 SASI_Rn02_00249687 predicted 914
8 SASI_Rn02_00249688 predicted 928
9 SASI_Rn02_00249689 predicted 730
10 SASI_Rn02_00249690 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028362 predicted 522
2 SASI_Mm02_00339400 predicted 779
3 SASI_Mm01_00028363 predicted 847
4 SASI_Mm01_00028364 predicted 429
5 SASI_Mm01_00028365 predicted 488
6 SASI_Mm01_00028366 predicted 895
7 SASI_Mm01_00028367 predicted 915
8 SASI_Mm01_00028368 predicted 708
9 SASI_Mm01_00028369 predicted 410
10 SASI_Mm01_00028370 predicted 880
11 SASI_Mm01_00028371 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018093
WDR74 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 74
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-779s21c1
Sequence:CCGGACCACCAGGTCCGTGTTTATGCTCGAGCATAAACACGGACCTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-1276s21c1
Sequence:CCGGCTCCAAACGAGACGGAGAAAGCTCGAGCTTTCTCCGTCTCGTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-379s21c1
Sequence:CCGGAGCACCGAGGATGGCATATTCCTCGAGGAATATGCCATCCTCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-884s1c1
Sequence:CCGGGCAACTCAGTGATTGTGGGAACTCGAGTTCCCACAATCACTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-466s1c1
Sequence:CCGGCTCATCACATGTGTGGATTCTCTCGAGAGAATCCACACATGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-916s1c1
Sequence:CCGGCAGCTGGCAGAAATTGACCTTCTCGAGAAGGTCAATTTCTGCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-624s1c1
Sequence:CCGGGAATGCTTTGAAGATATGGGACTCGAGTCCCATATCTTCAAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-1186s1c1
Sequence:CCGGCTAGAAGACACAGAGACAGATCTCGAGATCTGTCTCTGTGTCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-614s1c1
Sequence:CCGGGTGGGAAAGAGAATGCTTTGACTCGAGTCAAAGCATTCTCTTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-1192s1c1
Sequence:CCGGGACACAGAGACAGATGAACTTCTCGAGAAGTTCATCTGTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-489s1c1
Sequence:CCGGGATTCTCAGAGTCTGGCATGACTCGAGTCATGCCAGACTCTGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018093
WDR74 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 74
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-779s21c1
Sequence:CCGGACCACCAGGTCCGTGTTTATGCTCGAGCATAAACACGGACCTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-1276s21c1
Sequence:CCGGCTCCAAACGAGACGGAGAAAGCTCGAGCTTTCTCCGTCTCGTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-379s21c1
Sequence:CCGGAGCACCGAGGATGGCATATTCCTCGAGGAATATGCCATCCTCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-884s1c1
Sequence:CCGGGCAACTCAGTGATTGTGGGAACTCGAGTTCCCACAATCACTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-466s1c1
Sequence:CCGGCTCATCACATGTGTGGATTCTCTCGAGAGAATCCACACATGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-916s1c1
Sequence:CCGGCAGCTGGCAGAAATTGACCTTCTCGAGAAGGTCAATTTCTGCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-624s1c1
Sequence:CCGGGAATGCTTTGAAGATATGGGACTCGAGTCCCATATCTTCAAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-1186s1c1
Sequence:CCGGCTAGAAGACACAGAGACAGATCTCGAGATCTGTCTCTGTGTCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-614s1c1
Sequence:CCGGGTGGGAAAGAGAATGCTTTGACTCGAGTCAAAGCATTCTCTTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-1192s1c1
Sequence:CCGGGACACAGAGACAGATGAACTTCTCGAGAAGTTCATCTGTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-489s1c1
Sequence:CCGGGATTCTCAGAGTCTGGCATGACTCGAGTCATGCCAGACTCTGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018093
WDR74 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 74
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-779s21c1
Sequence:CCGGACCACCAGGTCCGTGTTTATGCTCGAGCATAAACACGGACCTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-1276s21c1
Sequence:CCGGCTCCAAACGAGACGGAGAAAGCTCGAGCTTTCTCCGTCTCGTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018093.2-379s21c1
Sequence:CCGGAGCACCGAGGATGGCATATTCCTCGAGGAATATGCCATCCTCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-884s1c1
Sequence:CCGGGCAACTCAGTGATTGTGGGAACTCGAGTTCCCACAATCACTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-466s1c1
Sequence:CCGGCTCATCACATGTGTGGATTCTCTCGAGAGAATCCACACATGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-916s1c1
Sequence:CCGGCAGCTGGCAGAAATTGACCTTCTCGAGAAGGTCAATTTCTGCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-624s1c1
Sequence:CCGGGAATGCTTTGAAGATATGGGACTCGAGTCCCATATCTTCAAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-1186s1c1
Sequence:CCGGCTAGAAGACACAGAGACAGATCTCGAGATCTGTCTCTGTGTCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-614s1c1
Sequence:CCGGGTGGGAAAGAGAATGCTTTGACTCGAGTCAAAGCATTCTCTTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018093.1-1192s1c1
Sequence:CCGGGACACAGAGACAGATGAACTTCTCGAGAAGTTCATCTGTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018093.1-489s1c1
Sequence:CCGGGATTCTCAGAGTCTGGCATGACTCGAGTCATGCCAGACTCTGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134139
VALIDATED
WDR74 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 74
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-194s21c1
Sequence:CCGGACAGAACCGTGAGGTACTTTACTCGAGTAAAGTACCTCACGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-912s21c1
Sequence:CCGGGCTAGAGCATAAGGTTTATCTCTCGAGAGATAAACCTTATGCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-299s21c1
Sequence:CCGGCCCTTATCACATGTGTGGATTCTCGAGAATCCACACATGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-1006s21c1
Sequence:CCGGCCCAACCAAGTACCCTCAGAACTCGAGTTCTGAGGGTACTTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134139.1-81s21c1
Sequence:CCGGGCGGAAACATGCGGCAAATTTCTCGAGAAATTTGCCGCATGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-299s1c1
Sequence:CCGGCCCTTATCACATGTGTGGATTCTCGAGAATCCACACATGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-544s1c1
Sequence:CCGGCGAGTTCCTATTTGGGACCAACTCGAGTTGGTCCCAAATAGGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-912s1c1
Sequence:CCGGGCTAGAGCATAAGGTTTATCTCTCGAGAGATAAACCTTATGCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-1006s1c1
Sequence:CCGGCCCAACCAAGTACCCTCAGAACTCGAGTTCTGAGGGTACTTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-463s1c1
Sequence:CCGGGCTTTGAAAGTATGGGACCTACTCGAGTAGGTCCCATACTTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134139
VALIDATED
WDR74 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 74
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-194s21c1
Sequence:CCGGACAGAACCGTGAGGTACTTTACTCGAGTAAAGTACCTCACGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-912s21c1
Sequence:CCGGGCTAGAGCATAAGGTTTATCTCTCGAGAGATAAACCTTATGCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-299s21c1
Sequence:CCGGCCCTTATCACATGTGTGGATTCTCGAGAATCCACACATGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-1006s21c1
Sequence:CCGGCCCAACCAAGTACCCTCAGAACTCGAGTTCTGAGGGTACTTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134139.1-81s21c1
Sequence:CCGGGCGGAAACATGCGGCAAATTTCTCGAGAAATTTGCCGCATGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-299s1c1
Sequence:CCGGCCCTTATCACATGTGTGGATTCTCGAGAATCCACACATGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-544s1c1
Sequence:CCGGCGAGTTCCTATTTGGGACCAACTCGAGTTGGTCCCAAATAGGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-912s1c1
Sequence:CCGGGCTAGAGCATAAGGTTTATCTCTCGAGAGATAAACCTTATGCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-1006s1c1
Sequence:CCGGCCCAACCAAGTACCCTCAGAACTCGAGTTCTGAGGGTACTTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-463s1c1
Sequence:CCGGGCTTTGAAAGTATGGGACCTACTCGAGTAGGTCCCATACTTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134139
VALIDATED
WDR74 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 74
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-194s21c1
Sequence:CCGGACAGAACCGTGAGGTACTTTACTCGAGTAAAGTACCTCACGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-912s21c1
Sequence:CCGGGCTAGAGCATAAGGTTTATCTCTCGAGAGATAAACCTTATGCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-299s21c1
Sequence:CCGGCCCTTATCACATGTGTGGATTCTCGAGAATCCACACATGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134139.1-1006s21c1
Sequence:CCGGCCCAACCAAGTACCCTCAGAACTCGAGTTCTGAGGGTACTTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134139.1-81s21c1
Sequence:CCGGGCGGAAACATGCGGCAAATTTCTCGAGAAATTTGCCGCATGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-299s1c1
Sequence:CCGGCCCTTATCACATGTGTGGATTCTCGAGAATCCACACATGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-544s1c1
Sequence:CCGGCGAGTTCCTATTTGGGACCAACTCGAGTTGGTCCCAAATAGGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-912s1c1
Sequence:CCGGGCTAGAGCATAAGGTTTATCTCTCGAGAGATAAACCTTATGCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-1006s1c1
Sequence:CCGGCCCAACCAAGTACCCTCAGAACTCGAGTTCTGAGGGTACTTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134139.1-463s1c1
Sequence:CCGGGCTTTGAAAGTATGGGACCTACTCGAGTAGGTCCCATACTTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks