EMAIL THIS PAGE TO A FRIEND

WDR75

WD repeat domain 75

Synonyms: NET16 UTP17
UniProtKB ID: Q8IWA0, Q96J10, Q9H8U8, Q9H9U5, Q9H9V8, Q9UIX2
Gene ID:
Mouse(73674) WD repeat domain 75
Rat(314545) WD repeat domain 75
naked mole-rat(101706037) WD repeat domain 75
Domestic Rabbit(100355194) WD repeat domain 75
domestic guinea pig(100722310) WD repeat domain 75
cow(521240) WD repeat domain 75
sheep(101114244) WD repeat domain 75
Zebrafish(368478) WD repeat domain 75
domestic cat(101100321) WD repeat domain 75
chicken(423985) WD repeat domain 75
dog(488443) WD repeat domain 75
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032168 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032168 Rosetta Predictions human pricing
NM_001047889 Rosetta Predictions rat pricing
NM_028599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359418 predicted 613
2 SASI_Hs01_00217073 predicted 1519
3 SASI_Hs01_00217074 predicted 1387
4 SASI_Hs01_00217075 predicted 2342
5 SASI_Hs02_00359419 predicted 792
6 SASI_Hs01_00217078 predicted 1837
7 SASI_Hs01_00217079 predicted 1952
8 SASI_Hs01_00217080 predicted 862
9 SASI_Hs01_00217081 predicted 1718
10 SASI_Hs02_00359420 predicted 1988
11 SASI_Hs01_00217076 predicted 267
12 SASI_Hs01_00217077 predicted 2184
13 SASI_Hs01_00217082 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206527 predicted 431
2 SASI_Rn02_00206528 predicted 1610
3 SASI_Rn02_00206529 predicted 1343
4 SASI_Rn02_00206530 predicted 1623
5 SASI_Rn02_00206531 predicted 730
6 SASI_Rn02_00206532 predicted 541
7 SASI_Rn02_00206533 predicted 923
8 SASI_Rn02_00206534 predicted 307
9 SASI_Rn02_00206535 predicted 1426
10 SASI_Rn02_00206536 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144469 predicted 993
2 SASI_Mm01_00144470 predicted 1905
3 SASI_Mm01_00144471 predicted 2199
4 SASI_Mm01_00144472 predicted 283
5 SASI_Mm01_00144473 predicted 1113
6 SASI_Mm02_00334081 predicted 1434
7 SASI_Mm01_00144475 predicted 1105
8 SASI_Mm01_00144476 predicted 242
9 SASI_Mm02_00334082 predicted 932
10 SASI_Mm01_00144478 predicted 1477
11 SASI_Mm01_00144474 predicted 2368
12 SASI_Mm01_00144477 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032168
VALIDATED
WDR75 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 75
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-1978s1c1
Sequence:CCGGCCTGAATCCTTCACCTCAGAACTCGAGTTCTGAGGTGAAGGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032168.1-1585s1c1
Sequence:CCGGGATGGTTCTTTACTAGCAGTTCTCGAGAACTGCTAGTAAAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032168.1-2350s1c1
Sequence:CCGGGCTAAGGAAATTCCTGAAGATCTCGAGATCTTCAGGAATTTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-430s1c1
Sequence:CCGGCCAGATATATTTCAGCTGGTTCTCGAGAACCAGCTGAAATATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032168.1-2095s1c1
Sequence:CCGGCCAACAAGCAAACAGCTGCTACTCGAGTAGCAGCTGTTTGCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-1823s1c1
Sequence:CCGGCCGATCCTAATTCAGAGAATACTCGAGTATTCTCTGAATTAGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-919s21c1
Sequence:CCGGCCGCGTTTAGGAGCTACTATTCTCGAGAATAGTAGCTCCTAAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-953s21c1
Sequence:CCGGTCTCGCCTGCAGGAGATTTATCTCGAGATAAATCTCCTGCAGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-288s21c1
Sequence:CCGGTTCCCTTGATGGCACAATTAACTCGAGTTAATTGTGCCATCAAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032168
VALIDATED
WDR75 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 75
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-1978s1c1
Sequence:CCGGCCTGAATCCTTCACCTCAGAACTCGAGTTCTGAGGTGAAGGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032168.1-1585s1c1
Sequence:CCGGGATGGTTCTTTACTAGCAGTTCTCGAGAACTGCTAGTAAAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032168.1-2350s1c1
Sequence:CCGGGCTAAGGAAATTCCTGAAGATCTCGAGATCTTCAGGAATTTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-430s1c1
Sequence:CCGGCCAGATATATTTCAGCTGGTTCTCGAGAACCAGCTGAAATATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032168.1-2095s1c1
Sequence:CCGGCCAACAAGCAAACAGCTGCTACTCGAGTAGCAGCTGTTTGCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-1823s1c1
Sequence:CCGGCCGATCCTAATTCAGAGAATACTCGAGTATTCTCTGAATTAGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-919s21c1
Sequence:CCGGCCGCGTTTAGGAGCTACTATTCTCGAGAATAGTAGCTCCTAAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-953s21c1
Sequence:CCGGTCTCGCCTGCAGGAGATTTATCTCGAGATAAATCTCCTGCAGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-288s21c1
Sequence:CCGGTTCCCTTGATGGCACAATTAACTCGAGTTAATTGTGCCATCAAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032168
VALIDATED
WDR75 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 75
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-1978s1c1
Sequence:CCGGCCTGAATCCTTCACCTCAGAACTCGAGTTCTGAGGTGAAGGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032168.1-1585s1c1
Sequence:CCGGGATGGTTCTTTACTAGCAGTTCTCGAGAACTGCTAGTAAAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032168.1-2350s1c1
Sequence:CCGGGCTAAGGAAATTCCTGAAGATCTCGAGATCTTCAGGAATTTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-430s1c1
Sequence:CCGGCCAGATATATTTCAGCTGGTTCTCGAGAACCAGCTGAAATATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032168.1-2095s1c1
Sequence:CCGGCCAACAAGCAAACAGCTGCTACTCGAGTAGCAGCTGTTTGCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032168.1-1823s1c1
Sequence:CCGGCCGATCCTAATTCAGAGAATACTCGAGTATTCTCTGAATTAGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-919s21c1
Sequence:CCGGCCGCGTTTAGGAGCTACTATTCTCGAGAATAGTAGCTCCTAAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-953s21c1
Sequence:CCGGTCTCGCCTGCAGGAGATTTATCTCGAGATAAATCTCCTGCAGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032168.1-288s21c1
Sequence:CCGGTTCCCTTGATGGCACAATTAACTCGAGTTAATTGTGCCATCAAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028599
VALIDATED
WDR75 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 75
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.1-1716s1c1
Sequence:CCGGGCTGTTGGAATCTGCTCAGTTCTCGAGAACTGAGCAGATTCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-1423s1c1
Sequence:CCGGCACTTCAAAGTGTGGATATTACTCGAGTAATATCCACACTTTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-877s1c1
Sequence:CCGGCCTCGATTAGGATCTTCTATTCTCGAGAATAGAAGATCCTAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-1997s1c1
Sequence:CCGGCGAAGTCACAGAGCTTATTAACTCGAGTTAATAAGCTCTGTGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-978s21c1
Sequence:CCGGTCTTGATGCATCGGCAGTAATCTCGAGATTACTGCCGATGCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028599.2-1006s21c1
Sequence:CCGGCTAGTTAAAGATAGGAGTATACTCGAGTATACTCCTATCTTTAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-90s21c1
Sequence:CCGGCTCCGTGGATTCCAAGTATATCTCGAGATATACTTGGAATCCACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-1155s21c1
Sequence:CCGGCATCAATGATGAGGGTCTAACCTCGAGGTTAGACCCTCATCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-1997s21c1
Sequence:CCGGCGAAGTCACAGAGCTTATTAACTCGAGTTAATAAGCTCTGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028599
VALIDATED
WDR75 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 75
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.1-1716s1c1
Sequence:CCGGGCTGTTGGAATCTGCTCAGTTCTCGAGAACTGAGCAGATTCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-1423s1c1
Sequence:CCGGCACTTCAAAGTGTGGATATTACTCGAGTAATATCCACACTTTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-877s1c1
Sequence:CCGGCCTCGATTAGGATCTTCTATTCTCGAGAATAGAAGATCCTAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-1997s1c1
Sequence:CCGGCGAAGTCACAGAGCTTATTAACTCGAGTTAATAAGCTCTGTGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-978s21c1
Sequence:CCGGTCTTGATGCATCGGCAGTAATCTCGAGATTACTGCCGATGCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028599.2-1006s21c1
Sequence:CCGGCTAGTTAAAGATAGGAGTATACTCGAGTATACTCCTATCTTTAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-90s21c1
Sequence:CCGGCTCCGTGGATTCCAAGTATATCTCGAGATATACTTGGAATCCACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-1155s21c1
Sequence:CCGGCATCAATGATGAGGGTCTAACCTCGAGGTTAGACCCTCATCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-1997s21c1
Sequence:CCGGCGAAGTCACAGAGCTTATTAACTCGAGTTAATAAGCTCTGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028599
VALIDATED
WDR75 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 75
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.1-1716s1c1
Sequence:CCGGGCTGTTGGAATCTGCTCAGTTCTCGAGAACTGAGCAGATTCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-1423s1c1
Sequence:CCGGCACTTCAAAGTGTGGATATTACTCGAGTAATATCCACACTTTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-877s1c1
Sequence:CCGGCCTCGATTAGGATCTTCTATTCTCGAGAATAGAAGATCCTAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028599.2-1997s1c1
Sequence:CCGGCGAAGTCACAGAGCTTATTAACTCGAGTTAATAAGCTCTGTGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-978s21c1
Sequence:CCGGTCTTGATGCATCGGCAGTAATCTCGAGATTACTGCCGATGCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028599.2-1006s21c1
Sequence:CCGGCTAGTTAAAGATAGGAGTATACTCGAGTATACTCCTATCTTTAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-90s21c1
Sequence:CCGGCTCCGTGGATTCCAAGTATATCTCGAGATATACTTGGAATCCACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-1155s21c1
Sequence:CCGGCATCAATGATGAGGGTCTAACCTCGAGGTTAGACCCTCATCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028599.2-1997s21c1
Sequence:CCGGCGAAGTCACAGAGCTTATTAACTCGAGTTAATAAGCTCTGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks