EMAIL THIS PAGE TO A FRIEND

WDR76

WD repeat domain 76

Synonyms: CDW14
UniProtKB ID: Q9H967, A0MNP5, Q05CI4
Gene ID:
Mouse(241627) WD repeat domain 76
Rat(311361) WD repeat domain 76
Zebrafish(570063) WD repeat domain 76
Horse(100070718) WD repeat domain 76
chicken(426208) WD repeat domain 76
dog(487529) WD repeat domain 76
domestic cat(101095830) WD repeat domain 76
cow(515302) WD repeat domain 76
sheep(101110541) WD repeat domain 76
domestic guinea pig(100718975) WD repeat domain 76
Domestic Rabbit(100328690) WD repeat domain 76
naked mole-rat(101697052) WD repeat domain 76
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024908 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024908 Rosetta Predictions human pricing
XM_230512 Rosetta Predictions rat pricing
NM_030234 Rosetta Predictions mouse pricing
XM_001004264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062255 predicted 897
2 SASI_Hs02_00357511 predicted 1251
3 SASI_Hs01_00062256 predicted 1100
4 SASI_Hs01_00062258 predicted 802
5 SASI_Hs01_00062259 predicted 654
6 SASI_Hs01_00062261 predicted 1158
7 SASI_Hs01_00062262 predicted 1270
8 SASI_Hs01_00062263 predicted 736
9 SASI_Hs01_00062264 predicted 1845
10 SASI_Hs02_00357512 predicted 1024
11 SASI_Hs01_00062257 predicted 764
12 SASI_Hs01_00062260 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386306 predicted 726
2 SASI_Rn02_00386307 predicted 1558
3 SASI_Rn02_00386308 predicted 337
4 SASI_Rn02_00386309 predicted 883
5 SASI_Rn02_00386310 predicted 1069
6 SASI_Rn02_00386311 predicted 810
7 SASI_Rn02_00386312 predicted 455
8 SASI_Rn02_00386313 predicted 1000
9 SASI_Rn02_00386314 predicted 277
10 SASI_Rn02_00386315 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336681 predicted 1894
2 SASI_Mm02_00336682 predicted 1465
3 SASI_Mm02_00336683 predicted 895
4 SASI_Mm02_00336684 predicted 1193
5 SASI_Mm02_00336685 predicted 1998
6 SASI_Mm02_00336686 predicted 1083
7 SASI_Mm02_00336687 predicted 1339
8 SASI_Mm02_00336688 predicted 812
9 SASI_Mm02_00336689 predicted 1943
10 SASI_Mm02_00336690 predicted 1949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257156 predicted 1443
2 SASI_Mm01_00257157 predicted 1080
3 SASI_Mm01_00257158 predicted 863
4 SASI_Mm01_00257159 predicted 1157
5 SASI_Mm01_00257160 predicted 1051
6 SASI_Mm01_00257161 predicted 1319
7 SASI_Mm01_00257162 predicted 784
8 SASI_Mm01_00257163 predicted 1258
9 SASI_Mm01_00257164 predicted 1410
10 SASI_Mm01_00257165 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030234
VALIDATED
WDR76 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 76
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030234.2-1558s21c1
Sequence:CCGGAGCATTGCCTCTGCATATTTCCTCGAGGAAATATGCAGAGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030234.2-2493s21c1
Sequence:CCGGAGACCATCTAAGACTAATTATCTCGAGATAATTAGTCTTAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030234.2-630s21c1
Sequence:CCGGACGGCTCCGTGGGATGATAAACTCGAGTTTATCATCCCACGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030234.2-414s21c1
Sequence:CCGGATCATCCGTGGATGCTTATACCTCGAGGTATAAGCATCCACGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030234.2-1870s21c1
Sequence:CCGGGTGCATCCTACGCGATATATCCTCGAGGATATATCGCGTAGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030234
VALIDATED
WDR76 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 76
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030234.2-1558s21c1
Sequence:CCGGAGCATTGCCTCTGCATATTTCCTCGAGGAAATATGCAGAGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030234.2-2493s21c1
Sequence:CCGGAGACCATCTAAGACTAATTATCTCGAGATAATTAGTCTTAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030234.2-630s21c1
Sequence:CCGGACGGCTCCGTGGGATGATAAACTCGAGTTTATCATCCCACGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030234.2-414s21c1
Sequence:CCGGATCATCCGTGGATGCTTATACCTCGAGGTATAAGCATCCACGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030234.2-1870s21c1
Sequence:CCGGGTGCATCCTACGCGATATATCCTCGAGGATATATCGCGTAGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030234
VALIDATED
WDR76 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 76
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030234.2-1558s21c1
Sequence:CCGGAGCATTGCCTCTGCATATTTCCTCGAGGAAATATGCAGAGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030234.2-2493s21c1
Sequence:CCGGAGACCATCTAAGACTAATTATCTCGAGATAATTAGTCTTAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030234.2-630s21c1
Sequence:CCGGACGGCTCCGTGGGATGATAAACTCGAGTTTATCATCCCACGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030234.2-414s21c1
Sequence:CCGGATCATCCGTGGATGCTTATACCTCGAGGTATAAGCATCCACGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030234.2-1870s21c1
Sequence:CCGGGTGCATCCTACGCGATATATCCTCGAGGATATATCGCGTAGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024908
VALIDATED
WDR76 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 76
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-953s21c1
Sequence:CCGGAGTTACCACAGGCCCAATATTCTCGAGAATATTGGGCCTGTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1825s21c1
Sequence:CCGGTGCACCCAACTCGGTATATTTCTCGAGAAATATACCGAGTTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1426s21c1
Sequence:CCGGGATTGAGGGATACTCATATTTCTCGAGAAATATGAGTATCCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-803s21c1
Sequence:CCGGAGACAACAATGAACGATTTAACTCGAGTTAAATCGTTCATTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1944s21c1
Sequence:CCGGCTGTCTAAGGAGCCTAGTAATCTCGAGATTACTAGGCTCCTTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167159    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024908.1-1973s1c1
Sequence:CCGGCCTTAGTGTGTTTATGTGGTACTCGAGTACCACATAAACACACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024908.1-1776s1c1
Sequence:CCGGGCATTCGTTTGGTGGAGAATACTCGAGTATTCTCCACCAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024908
VALIDATED
WDR76 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 76
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-953s21c1
Sequence:CCGGAGTTACCACAGGCCCAATATTCTCGAGAATATTGGGCCTGTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1825s21c1
Sequence:CCGGTGCACCCAACTCGGTATATTTCTCGAGAAATATACCGAGTTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1426s21c1
Sequence:CCGGGATTGAGGGATACTCATATTTCTCGAGAAATATGAGTATCCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-803s21c1
Sequence:CCGGAGACAACAATGAACGATTTAACTCGAGTTAAATCGTTCATTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1944s21c1
Sequence:CCGGCTGTCTAAGGAGCCTAGTAATCTCGAGATTACTAGGCTCCTTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167159    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024908.1-1973s1c1
Sequence:CCGGCCTTAGTGTGTTTATGTGGTACTCGAGTACCACATAAACACACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024908.1-1776s1c1
Sequence:CCGGGCATTCGTTTGGTGGAGAATACTCGAGTATTCTCCACCAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024908
VALIDATED
WDR76 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 76
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-953s21c1
Sequence:CCGGAGTTACCACAGGCCCAATATTCTCGAGAATATTGGGCCTGTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1825s21c1
Sequence:CCGGTGCACCCAACTCGGTATATTTCTCGAGAAATATACCGAGTTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1426s21c1
Sequence:CCGGGATTGAGGGATACTCATATTTCTCGAGAAATATGAGTATCCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-803s21c1
Sequence:CCGGAGACAACAATGAACGATTTAACTCGAGTTAAATCGTTCATTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024908.2-1944s21c1
Sequence:CCGGCTGTCTAAGGAGCCTAGTAATCTCGAGATTACTAGGCTCCTTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167159    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024908.1-1973s1c1
Sequence:CCGGCCTTAGTGTGTTTATGTGGTACTCGAGTACCACATAAACACACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024908.1-1776s1c1
Sequence:CCGGGCATTCGTTTGGTGGAGAATACTCGAGTATTCTCCACCAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks