EMAIL THIS PAGE TO A FRIEND

WDR77

WD repeat domain 77

Synonyms: MEP-50 MEP50 Nbla10071 RP11-552M11.3 p44 p44/Mep50
Gene ID:
Human(79084) Summary: WDR77 is a component of the 20S PRMT5 (MIM 604045)-containing methyltransferase complex, which modifies specific arginines to dimethylarginines in several spliceosomal Sm proteins (see MIM 601061). This modification targets Sm proteins to the survival of motor neurons (SMN) complex (see MIM 600354) for assembly into small nuclear ribonucleoprotein core particles (Friesen et al., 2002 [PubMed 11756452]
Mouse(70465) WD repeat domain 77
Rat(310769) WD repeat domain 77
naked mole-rat(101696893) WD repeat domain 77
domestic guinea pig(100713057) WD repeat domain 77
cow(512993) WD repeat domain 77
sheep(101114321) WD repeat domain 77
Zebrafish(393506) WD repeat domain 77
domestic cat(101094438) WD repeat domain 77
dog(479902) WD repeat domain 77
chicken(419865) WD repeat domain 77
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024102 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024102 Rosetta Predictions human pricing
NM_001008771 Rosetta Predictions rat pricing
NM_027432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203544 predicted 924
2 SASI_Hs01_00203545 predicted 390
3 SASI_Hs01_00203546 predicted 1061
4 SASI_Hs01_00203547 predicted 440
5 SASI_Hs01_00203548 predicted 325
6 SASI_Hs01_00203549 predicted 376
7 SASI_Hs01_00203550 predicted 415
8 SASI_Hs01_00203551 predicted 700
9 SASI_Hs01_00203552 predicted 325
10 SASI_Hs01_00203553 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107287 predicted 322
2 SASI_Rn01_00107289 predicted 946
3 SASI_Rn01_00107290 predicted 402
4 SASI_Rn01_00107292 predicted 477
5 SASI_Rn01_00107293 predicted 744
6 SASI_Rn01_00107294 predicted 930
7 SASI_Rn01_00107295 predicted 381
8 SASI_Rn01_00107296 predicted 1060
9 SASI_Rn02_00199290 predicted 335
10 SASI_Rn02_00199291 predicted 979
11 SASI_Rn01_00107288 predicted 586
12 SASI_Rn01_00107291 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197824 predicted 968
2 SASI_Mm01_00197825 predicted 438
3 SASI_Mm01_00197826 predicted 373
4 SASI_Mm01_00197827 predicted 356
5 SASI_Mm01_00197828 predicted 1234
6 SASI_Mm01_00197829 predicted 1396
7 SASI_Mm01_00197830 predicted 777
8 SASI_Mm01_00197831 predicted 1109
9 SASI_Mm01_00197832 predicted 940
10 SASI_Mm02_00332187 predicted 1059
11 SASI_Mm01_00197833 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027432
VALIDATED
WDR77 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 77
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027432.3-972s1c1
Sequence:CCGGCACAGAGACTTTGTGAGAGATCTCGAGATCTCTCACAAAGTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027432.3-2550s1c1
Sequence:CCGGCAGTAAATGACAGGCATAATTCTCGAGAATTATGCCTGTCATTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027432.3-2680s1c1
Sequence:CCGGGAGGTAACACTAGGGTTATTTCTCGAGAAATAACCCTAGTGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-643s21c1
Sequence:CCGGGTAGTGAGGACAGTAGAATTTCTCGAGAAATTCTACTGTCCTCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-994s21c1
Sequence:CCGGCTACGTGGTCTCCACTCAATCCTCGAGGATTGAGTGGAGACCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-158s21c1
Sequence:CCGGCGCATGCATGGAACGTCAATTCTCGAGAATTGACGTTCCATGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027432.3-2550s21c1
Sequence:CCGGCAGTAAATGACAGGCATAATTCTCGAGAATTATGCCTGTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027432.3-940s21c1
Sequence:CCGGCAAGCCTTTCTGAGGTGTTTACTCGAGTAAACACCTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027432
VALIDATED
WDR77 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 77
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027432.3-972s1c1
Sequence:CCGGCACAGAGACTTTGTGAGAGATCTCGAGATCTCTCACAAAGTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027432.3-2550s1c1
Sequence:CCGGCAGTAAATGACAGGCATAATTCTCGAGAATTATGCCTGTCATTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027432.3-2680s1c1
Sequence:CCGGGAGGTAACACTAGGGTTATTTCTCGAGAAATAACCCTAGTGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-643s21c1
Sequence:CCGGGTAGTGAGGACAGTAGAATTTCTCGAGAAATTCTACTGTCCTCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-994s21c1
Sequence:CCGGCTACGTGGTCTCCACTCAATCCTCGAGGATTGAGTGGAGACCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-158s21c1
Sequence:CCGGCGCATGCATGGAACGTCAATTCTCGAGAATTGACGTTCCATGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027432.3-2550s21c1
Sequence:CCGGCAGTAAATGACAGGCATAATTCTCGAGAATTATGCCTGTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027432.3-940s21c1
Sequence:CCGGCAAGCCTTTCTGAGGTGTTTACTCGAGTAAACACCTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027432
VALIDATED
WDR77 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 77
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027432.3-972s1c1
Sequence:CCGGCACAGAGACTTTGTGAGAGATCTCGAGATCTCTCACAAAGTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027432.3-2550s1c1
Sequence:CCGGCAGTAAATGACAGGCATAATTCTCGAGAATTATGCCTGTCATTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027432.3-2680s1c1
Sequence:CCGGGAGGTAACACTAGGGTTATTTCTCGAGAAATAACCCTAGTGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-643s21c1
Sequence:CCGGGTAGTGAGGACAGTAGAATTTCTCGAGAAATTCTACTGTCCTCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-994s21c1
Sequence:CCGGCTACGTGGTCTCCACTCAATCCTCGAGGATTGAGTGGAGACCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027432.3-158s21c1
Sequence:CCGGCGCATGCATGGAACGTCAATTCTCGAGAATTGACGTTCCATGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027432.3-2550s21c1
Sequence:CCGGCAGTAAATGACAGGCATAATTCTCGAGAATTATGCCTGTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027432.3-940s21c1
Sequence:CCGGCAAGCCTTTCTGAGGTGTTTACTCGAGTAAACACCTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024102
VALIDATED
WDR77 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 77
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-893s1c1
Sequence:CCGGCAAGCCTTTCTGAGTTGTTTACTCGAGTAAACAACTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-703s1c1
Sequence:CCGGCCTCAGCAAAGTGAAGTCTTTCTCGAGAAAGACTTCACTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-568s1c1
Sequence:CCGGCCTCACAAGGACTCTGTGTTTCTCGAGAAACACAGAGTCCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024102.2-1478s1c1
Sequence:CCGGGCAGCTCTTATGCTACTCATACTCGAGTATGAGTAGCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-708s1c1
Sequence:CCGGGCAAAGTGAAGTCTTTGTCTTCTCGAGAAGACAAAGACTTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-568s21c1
Sequence:CCGGCCTCACAAGGACTCTGTGTTTCTCGAGAAACACAGAGTCCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-708s21c1
Sequence:CCGGGCAAAGTGAAGTCTTTGTCTTCTCGAGAAGACAAAGACTTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024102.2-1478s21c1
Sequence:CCGGGCAGCTCTTATGCTACTCATACTCGAGTATGAGTAGCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-893s21c1
Sequence:CCGGCAAGCCTTTCTGAGTTGTTTACTCGAGTAAACAACTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024102
VALIDATED
WDR77 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 77
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-893s1c1
Sequence:CCGGCAAGCCTTTCTGAGTTGTTTACTCGAGTAAACAACTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-703s1c1
Sequence:CCGGCCTCAGCAAAGTGAAGTCTTTCTCGAGAAAGACTTCACTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-568s1c1
Sequence:CCGGCCTCACAAGGACTCTGTGTTTCTCGAGAAACACAGAGTCCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024102.2-1478s1c1
Sequence:CCGGGCAGCTCTTATGCTACTCATACTCGAGTATGAGTAGCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-708s1c1
Sequence:CCGGGCAAAGTGAAGTCTTTGTCTTCTCGAGAAGACAAAGACTTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-568s21c1
Sequence:CCGGCCTCACAAGGACTCTGTGTTTCTCGAGAAACACAGAGTCCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-708s21c1
Sequence:CCGGGCAAAGTGAAGTCTTTGTCTTCTCGAGAAGACAAAGACTTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024102.2-1478s21c1
Sequence:CCGGGCAGCTCTTATGCTACTCATACTCGAGTATGAGTAGCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-893s21c1
Sequence:CCGGCAAGCCTTTCTGAGTTGTTTACTCGAGTAAACAACTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024102
VALIDATED
WDR77 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 77
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-893s1c1
Sequence:CCGGCAAGCCTTTCTGAGTTGTTTACTCGAGTAAACAACTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-703s1c1
Sequence:CCGGCCTCAGCAAAGTGAAGTCTTTCTCGAGAAAGACTTCACTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-568s1c1
Sequence:CCGGCCTCACAAGGACTCTGTGTTTCTCGAGAAACACAGAGTCCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024102.2-1478s1c1
Sequence:CCGGGCAGCTCTTATGCTACTCATACTCGAGTATGAGTAGCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024102.2-708s1c1
Sequence:CCGGGCAAAGTGAAGTCTTTGTCTTCTCGAGAAGACAAAGACTTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-568s21c1
Sequence:CCGGCCTCACAAGGACTCTGTGTTTCTCGAGAAACACAGAGTCCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-708s21c1
Sequence:CCGGGCAAAGTGAAGTCTTTGTCTTCTCGAGAAGACAAAGACTTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024102.2-1478s21c1
Sequence:CCGGGCAGCTCTTATGCTACTCATACTCGAGTATGAGTAGCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024102.2-893s21c1
Sequence:CCGGCAAGCCTTTCTGAGTTGTTTACTCGAGTAAACAACTCAGAAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks