EMAIL THIS PAGE TO A FRIEND

WDR78

WD repeat domain 78

Synonyms: DIC4
Gene ID:
Mouse(242584) WD repeat domain 78
Rat(313417) WD repeat domain 78
Zebrafish(553797) WD repeat domain 78
chicken(429114) WD repeat domain 78
domestic cat(101086583) WD repeat domain 78
dog(479538) WD repeat domain 78
cow(535410) WD repeat domain 78
sheep(101113544) WD repeat domain 78
domestic guinea pig(100724153) WD repeat domain 78
naked mole-rat(101701327) WD repeat domain 78
Domestic Rabbit(100351421) WD repeat domain 78
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024763 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046651 MISSION® esiRNA esiRNA human WDR78 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024763 Rosetta Predictions human pricing
NM_207014 Rosetta Predictions human pricing
NM_001024786 Rosetta Predictions rat pricing
XM_001063301 Rosetta Predictions rat pricing
NM_146254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220421 predicted 1037
2 SASI_Hs01_00220422 predicted 269
3 SASI_Hs01_00220423 predicted 1239
4 SASI_Hs02_00357265 predicted 229
5 SASI_Hs01_00220426 predicted 452
6 SASI_Hs01_00220428 predicted 1077
7 SASI_Hs01_00220429 predicted 674
8 SASI_Hs02_00357266 predicted 508
9 SASI_Hs02_00357267 predicted 555
10 SASI_Hs02_00357268 predicted 950
11 SASI_Hs01_00220420 predicted 818
12 SASI_Hs01_00220424 predicted 597
13 SASI_Hs01_00220425 predicted 1316
14 SASI_Hs01_00220427 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104423 predicted 1037
2 SASI_Hs01_00104424 predicted 278
3 SASI_Hs01_00104425 predicted 1241
4 SASI_Hs02_00373707 predicted 231
5 SASI_Hs01_00104428 predicted 454
6 SASI_Hs01_00104430 predicted 1076
7 SASI_Hs01_00104431 predicted 670
8 SASI_Hs02_00373708 predicted 515
9 SASI_Hs02_00373709 predicted 554
10 SASI_Hs02_00373710 predicted 945
11 SASI_Hs01_00104422 predicted 816
12 SASI_Hs01_00104426 predicted 603
13 SASI_Hs01_00104427 predicted 1320
14 SASI_Hs01_00104429 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101875 predicted 216
2 SASI_Rn01_00101876 predicted 1821
3 SASI_Rn01_00101877 predicted 2182
4 SASI_Rn01_00101878 predicted 548
5 SASI_Rn02_00202692 predicted 1313
6 SASI_Rn01_00101881 predicted 2282
7 SASI_Rn01_00101882 predicted 1084
8 SASI_Rn01_00101883 predicted 2054
9 SASI_Rn01_00101884 predicted 1328
10 SASI_Rn02_00202693 predicted 506
11 SASI_Rn01_00101879 predicted 985
12 SASI_Rn01_00101880 predicted 1982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306580 predicted 566
2 SASI_Rn02_00306581 predicted 337
3 SASI_Rn02_00306582 predicted 596
4 SASI_Rn02_00306583 predicted 243
5 SASI_Rn02_00306584 predicted 622
6 SASI_Rn02_00306585 predicted 532
7 SASI_Rn02_00306586 predicted 267
8 SASI_Rn02_00306587 predicted 439
9 SASI_Rn02_00306588 predicted 408
10 SASI_Rn02_00306589 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047854 predicted 1921
2 SASI_Mm02_00341985 predicted 1128
3 SASI_Mm01_00047856 predicted 527
4 SASI_Mm01_00047857 predicted 1161
5 SASI_Mm01_00047858 predicted 282
6 SASI_Mm01_00047859 predicted 1259
7 SASI_Mm01_00047860 predicted 505
8 SASI_Mm02_00341986 predicted 1163
9 SASI_Mm01_00047862 predicted 1885
10 SASI_Mm02_00341987 predicted 628
11 SASI_Mm01_00047855 predicted 793
12 SASI_Mm01_00047861 predicted 1998
13 SASI_Mm01_00047863 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024763
WDR78 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 78
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-561s1c1
Sequence:CCGGCCTAGTACGTTAGGGCAGTTTCTCGAGAAACTGCCCTAACGTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-1647s1c1
Sequence:CCGGCGTATTTATCAGAGTCCATATCTCGAGATATGGACTCTGATAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-1038s1c1
Sequence:CCGGGCTATGGAACTTGTATCTTTACTCGAGTAAAGATACAAGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2581s1c1
Sequence:CCGGCCAAGTCAAACCAATCAGCATCTCGAGATGCTGATTGGTTTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024763.3-3187s1c1
Sequence:CCGGGCGCTTATCACATTCCCAATTCTCGAGAATTGGGAATGTGATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2446s1c1
Sequence:CCGGCCATTCTCTTTGCCAAACAAACTCGAGTTTGTTTGGCAAAGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024763.3-3434s1c1
Sequence:CCGGGCCATTCTATGCAGTTTGTTTCTCGAGAAACAAACTGCATAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2414s1c1
Sequence:CCGGGAATACTGCTAACCCTGGAATCTCGAGATTCCAGGGTTAGCAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024763
WDR78 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 78
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-561s1c1
Sequence:CCGGCCTAGTACGTTAGGGCAGTTTCTCGAGAAACTGCCCTAACGTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-1647s1c1
Sequence:CCGGCGTATTTATCAGAGTCCATATCTCGAGATATGGACTCTGATAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-1038s1c1
Sequence:CCGGGCTATGGAACTTGTATCTTTACTCGAGTAAAGATACAAGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2581s1c1
Sequence:CCGGCCAAGTCAAACCAATCAGCATCTCGAGATGCTGATTGGTTTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024763.3-3187s1c1
Sequence:CCGGGCGCTTATCACATTCCCAATTCTCGAGAATTGGGAATGTGATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2446s1c1
Sequence:CCGGCCATTCTCTTTGCCAAACAAACTCGAGTTTGTTTGGCAAAGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024763.3-3434s1c1
Sequence:CCGGGCCATTCTATGCAGTTTGTTTCTCGAGAAACAAACTGCATAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2414s1c1
Sequence:CCGGGAATACTGCTAACCCTGGAATCTCGAGATTCCAGGGTTAGCAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024763
WDR78 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 78
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-561s1c1
Sequence:CCGGCCTAGTACGTTAGGGCAGTTTCTCGAGAAACTGCCCTAACGTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-1647s1c1
Sequence:CCGGCGTATTTATCAGAGTCCATATCTCGAGATATGGACTCTGATAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-1038s1c1
Sequence:CCGGGCTATGGAACTTGTATCTTTACTCGAGTAAAGATACAAGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2581s1c1
Sequence:CCGGCCAAGTCAAACCAATCAGCATCTCGAGATGCTGATTGGTTTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024763.3-3187s1c1
Sequence:CCGGGCGCTTATCACATTCCCAATTCTCGAGAATTGGGAATGTGATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2446s1c1
Sequence:CCGGCCATTCTCTTTGCCAAACAAACTCGAGTTTGTTTGGCAAAGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024763.3-3434s1c1
Sequence:CCGGGCCATTCTATGCAGTTTGTTTCTCGAGAAACAAACTGCATAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024763.3-2414s1c1
Sequence:CCGGGAATACTGCTAACCCTGGAATCTCGAGATTCCAGGGTTAGCAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146254
WDR78 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 78
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-1535s1c1
Sequence:CCGGGCGTATTTATCAGAGTTCATACTCGAGTATGAACTCTGATAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-1707s1c1
Sequence:CCGGGTTTGGCAAGTGCAGTGGATACTCGAGTATCCACTGCACTTGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-400s1c1
Sequence:CCGGCGCTTGGATCAGATTATATTTCTCGAGAAATATAATCTGATCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146254.1-2045s1c1
Sequence:CCGGGCAGTCTACGAGCTGAGAAATCTCGAGATTTCTCAGCTCGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-215s1c1
Sequence:CCGGCGTATCAAGAACTATGGGTTTCTCGAGAAACCCATAGTTCTTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146254
WDR78 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 78
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-1535s1c1
Sequence:CCGGGCGTATTTATCAGAGTTCATACTCGAGTATGAACTCTGATAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-1707s1c1
Sequence:CCGGGTTTGGCAAGTGCAGTGGATACTCGAGTATCCACTGCACTTGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-400s1c1
Sequence:CCGGCGCTTGGATCAGATTATATTTCTCGAGAAATATAATCTGATCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146254.1-2045s1c1
Sequence:CCGGGCAGTCTACGAGCTGAGAAATCTCGAGATTTCTCAGCTCGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-215s1c1
Sequence:CCGGCGTATCAAGAACTATGGGTTTCTCGAGAAACCCATAGTTCTTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146254
WDR78 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 78
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-1535s1c1
Sequence:CCGGGCGTATTTATCAGAGTTCATACTCGAGTATGAACTCTGATAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-1707s1c1
Sequence:CCGGGTTTGGCAAGTGCAGTGGATACTCGAGTATCCACTGCACTTGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-400s1c1
Sequence:CCGGCGCTTGGATCAGATTATATTTCTCGAGAAATATAATCTGATCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146254.1-2045s1c1
Sequence:CCGGGCAGTCTACGAGCTGAGAAATCTCGAGATTTCTCAGCTCGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146254.1-215s1c1
Sequence:CCGGCGTATCAAGAACTATGGGTTTCTCGAGAAACCCATAGTTCTTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks