EMAIL THIS PAGE TO A FRIEND

WDR7

WD repeat domain 7

Synonyms: TRAG
UniProtKB ID: Q9Y4E6, A7E2C8, Q86UX5, Q86VP2, Q96PS7
Gene ID:
Human(23335) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(104082) WD repeat domain 7
Rat(66031) WD repeat domain 7
Zebrafish(572502) WD repeat domain 7
chicken(426855) WD repeat domain 7
dog(476191) WD repeat domain 7
Horse(100049995) WD repeat domain 7
domestic cat(101100093) WD repeat domain 7
cow(536469) WD repeat domain 7
sheep(101122069) WD repeat domain 7
domestic guinea pig(100728442) WD repeat domain 7
Domestic Rabbit(100343812) WD repeat domain 7
naked mole-rat(101711846) WD repeat domain 7
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042074 Anti-WDR7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_140391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015285 Rosetta Predictions human pricing
NM_052834 Rosetta Predictions human pricing
NM_023975 Rosetta Predictions rat pricing
XM_140391 Rosetta Predictions mouse pricing
XM_901910 Rosetta Predictions mouse pricing
XM_901912 Rosetta Predictions mouse pricing
XM_915908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065200 predicted 2253
2 SASI_Hs01_00065202 predicted 1140
3 SASI_Hs01_00065203 predicted 943
4 SASI_Hs02_00347469 predicted 4188
5 SASI_Hs01_00065205 predicted 4091
6 SASI_Hs02_00347470 predicted 2150
7 SASI_Hs02_00347471 predicted 1611
8 SASI_Hs02_00347472 predicted 3663
9 SASI_Hs01_00065208 predicted 1907
10 SASI_Hs01_00065209 predicted 799
11 SASI_Hs01_00065201 predicted 1241
12 SASI_Hs01_00065204 predicted 4292
13 SASI_Hs01_00065206 predicted 2012
14 SASI_Hs01_00065207 predicted 4279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093128 predicted 2247
2 SASI_Hs01_00093130 predicted 1142
3 SASI_Hs01_00093131 predicted 940
4 SASI_Hs02_00361513 predicted 4087
5 SASI_Hs01_00093133 predicted 3992
6 SASI_Hs02_00361514 predicted 2149
7 SASI_Hs02_00361515 predicted 1610
8 SASI_Hs02_00361516 predicted 3563
9 SASI_Hs01_00093136 predicted 1901
10 SASI_Hs01_00093137 predicted 802
11 SASI_Hs01_00093129 predicted 1234
12 SASI_Hs01_00093132 predicted 4187
13 SASI_Hs01_00093134 predicted 2007
14 SASI_Hs01_00093135 predicted 4173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040320 predicted 2352
2 SASI_Rn01_00040322 predicted 1025
3 SASI_Rn01_00040323 predicted 3899
4 SASI_Rn01_00040324 predicted 4049
5 SASI_Rn02_00263795 predicted 966
6 SASI_Rn01_00040325 predicted 1624
7 SASI_Rn01_00040326 predicted 1207
8 SASI_Rn02_00263796 predicted 1259
9 SASI_Rn02_00263797 predicted 2775
10 SASI_Rn01_00040327 predicted 2112
11 SASI_Rn01_00040321 predicted 2533
12 SASI_Rn01_00040328 predicted 4070
13 SASI_Rn01_00040329 predicted 3491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424954 predicted 3183
2 SASI_Mm01_00224380 predicted 1265
3 SASI_Mm02_00424955 predicted 1862
4 SASI_Mm01_00224381 predicted 925
5 SASI_Mm02_00424956 predicted 1444
6 SASI_Mm01_00224382 predicted 1494
7 SASI_Mm01_00224383 predicted 953
8 SASI_Mm01_00224384 predicted 825
9 SASI_Mm01_00224385 predicted 4279
10 SASI_Mm02_00424957 predicted 2914
11 SASI_Mm01_00224377 predicted 250
12 SASI_Mm01_00224378 predicted 3848
13 SASI_Mm01_00224379 predicted 4299
14 SASI_Mm01_00224386 predicted 4142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216137 predicted 685
2 SASI_Mm01_00216138 predicted 254
3 SASI_Mm01_00216139 predicted 1210
4 SASI_Mm01_00216140 predicted 1271
5 SASI_Mm01_00216141 predicted 1833
6 SASI_Mm01_00216142 predicted 1716
7 SASI_Mm01_00216143 predicted 930
8 SASI_Mm01_00216144 predicted 1450
9 SASI_Mm01_00216145 predicted 1364
10 SASI_Mm01_00216146 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203993 predicted 248
2 SASI_Mm01_00203994 predicted 3753
3 SASI_Mm01_00203995 predicted 4207
4 SASI_Mm01_00203996 predicted 1269
5 SASI_Mm01_00203997 predicted 933
6 SASI_Mm01_00203998 predicted 1493
7 SASI_Mm01_00203999 predicted 951
8 SASI_Mm01_00204000 predicted 830
9 SASI_Mm01_00204001 predicted 4190
10 SASI_Mm01_00204002 predicted 4046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439842 predicted 243
2 SASI_Mm02_00439843 predicted 1450
3 SASI_Mm02_00439844 predicted 3839
4 SASI_Mm02_00439845 predicted 1261
5 SASI_Mm02_00439846 predicted 930
6 SASI_Mm02_00439847 predicted 1490
7 SASI_Mm02_00439848 predicted 953
8 SASI_Mm02_00439849 predicted 829
9 SASI_Mm02_00439850 predicted 4281
10 SASI_Mm02_00439851 predicted 4137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015285
VALIDATED
WDR7 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-691s21c1
Sequence:CCGGGATTAGCTCCATGAGTATTATCTCGAGATAATACTCATGGAGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-776s21c1
Sequence:CCGGTGGATTGTTACCTCGGAAATACTCGAGTATTTCCGAGGTAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-319s21c1
Sequence:CCGGAGGATGTCACGACGGACAAATCTCGAGATTTGTCCGTCGTGACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-1691s21c1
Sequence:CCGGGTCATAATTTGGGACATATTTCTCGAGAAATATGTCCCAAATTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-930s21c1
Sequence:CCGGTGTTCGATGCCGGAGACTATTCTCGAGAATAGTCTCCGGCATCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015285.1-4005s1c1
Sequence:CCGGCCTTGAAGGATCTTTAGTTAACTCGAGTTAACTAAAGATCCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015285.1-4927s1c1
Sequence:CCGGCGATTGAAATTATTGCCCTTTCTCGAGAAAGGGCAATAATTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015285.1-169s1c1
Sequence:CCGGCGAGCACTGTTGTTTGGTCATCTCGAGATGACCAAACAACAGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015285.1-1202s1c1
Sequence:CCGGCCAATAGTAATGAACCTCTTACTCGAGTAAGAGGTTCATTACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015285
VALIDATED
WDR7 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-691s21c1
Sequence:CCGGGATTAGCTCCATGAGTATTATCTCGAGATAATACTCATGGAGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-776s21c1
Sequence:CCGGTGGATTGTTACCTCGGAAATACTCGAGTATTTCCGAGGTAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-319s21c1
Sequence:CCGGAGGATGTCACGACGGACAAATCTCGAGATTTGTCCGTCGTGACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-1691s21c1
Sequence:CCGGGTCATAATTTGGGACATATTTCTCGAGAAATATGTCCCAAATTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-930s21c1
Sequence:CCGGTGTTCGATGCCGGAGACTATTCTCGAGAATAGTCTCCGGCATCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015285.1-4005s1c1
Sequence:CCGGCCTTGAAGGATCTTTAGTTAACTCGAGTTAACTAAAGATCCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015285.1-4927s1c1
Sequence:CCGGCGATTGAAATTATTGCCCTTTCTCGAGAAAGGGCAATAATTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015285.1-169s1c1
Sequence:CCGGCGAGCACTGTTGTTTGGTCATCTCGAGATGACCAAACAACAGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015285.1-1202s1c1
Sequence:CCGGCCAATAGTAATGAACCTCTTACTCGAGTAAGAGGTTCATTACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015285
VALIDATED
WDR7 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-691s21c1
Sequence:CCGGGATTAGCTCCATGAGTATTATCTCGAGATAATACTCATGGAGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-776s21c1
Sequence:CCGGTGGATTGTTACCTCGGAAATACTCGAGTATTTCCGAGGTAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-319s21c1
Sequence:CCGGAGGATGTCACGACGGACAAATCTCGAGATTTGTCCGTCGTGACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-1691s21c1
Sequence:CCGGGTCATAATTTGGGACATATTTCTCGAGAAATATGTCCCAAATTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015285.2-930s21c1
Sequence:CCGGTGTTCGATGCCGGAGACTATTCTCGAGAATAGTCTCCGGCATCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015285.1-4005s1c1
Sequence:CCGGCCTTGAAGGATCTTTAGTTAACTCGAGTTAACTAAAGATCCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015285.1-4927s1c1
Sequence:CCGGCGATTGAAATTATTGCCCTTTCTCGAGAAAGGGCAATAATTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015285.1-169s1c1
Sequence:CCGGCGAGCACTGTTGTTTGGTCATCTCGAGATGACCAAACAACAGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015285.1-1202s1c1
Sequence:CCGGCCAATAGTAATGAACCTCTTACTCGAGTAAGAGGTTCATTACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140391
WDR7 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_140391.5-5441s21c1
Sequence:CCGGAGTTTAGGAGCAAGCATATTTCTCGAGAAATATGCTTGCTCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-2774s21c1
Sequence:CCGGCTGATGCTTCCCGGTTATAATCTCGAGATTATAACCGGGAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-1677s21c1
Sequence:CCGGATGACCAAAGATACCTGATATCTCGAGATATCAGGTATCTTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-1280s21c1
Sequence:CCGGGATTCTTCTGGAAGGTTAAATCTCGAGATTTAACCTTCCAGAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-833s21c1
Sequence:CCGGCAGGATACTGAGCCAATATTTCTCGAGAAATATTGGCTCAGTATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140391
WDR7 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_140391.5-5441s21c1
Sequence:CCGGAGTTTAGGAGCAAGCATATTTCTCGAGAAATATGCTTGCTCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-2774s21c1
Sequence:CCGGCTGATGCTTCCCGGTTATAATCTCGAGATTATAACCGGGAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-1677s21c1
Sequence:CCGGATGACCAAAGATACCTGATATCTCGAGATATCAGGTATCTTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-1280s21c1
Sequence:CCGGGATTCTTCTGGAAGGTTAAATCTCGAGATTTAACCTTCCAGAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-833s21c1
Sequence:CCGGCAGGATACTGAGCCAATATTTCTCGAGAAATATTGGCTCAGTATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140391
WDR7 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_140391.5-5441s21c1
Sequence:CCGGAGTTTAGGAGCAAGCATATTTCTCGAGAAATATGCTTGCTCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-2774s21c1
Sequence:CCGGCTGATGCTTCCCGGTTATAATCTCGAGATTATAACCGGGAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-1677s21c1
Sequence:CCGGATGACCAAAGATACCTGATATCTCGAGATATCAGGTATCTTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-1280s21c1
Sequence:CCGGGATTCTTCTGGAAGGTTAAATCTCGAGATTTAACCTTCCAGAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140391.5-833s21c1
Sequence:CCGGCAGGATACTGAGCCAATATTTCTCGAGAAATATTGGCTCAGTATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks