EMAIL THIS PAGE TO A FRIEND

WDR81

WD repeat domain 81

Synonyms: CAMRQ2
Gene ID:
Human(124997) Summary: This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(192652) WD repeat domain 81
Rat(303312) WD repeat domain 81
Zebrafish(324668) WD repeat domain 81
chicken(417560) WD repeat domain 81
domestic cat(101100426) WD repeat domain 81
dog(611263) WD repeat domain 81
naked mole-rat(101696549) WD repeat domain 81
domestic guinea pig(100735832) WD repeat domain 81
cow(514104) WD repeat domain 81
sheep(101116999) WD repeat domain 81
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152348 Rosetta Predictions human pricing
NM_001134360 Rosetta Predictions rat pricing
XM_001002633 Rosetta Predictions mouse pricing
XM_911699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201577 predicted 3021
2 SASI_Hs01_00201578 predicted 3126
3 SASI_Hs01_00201579 predicted 2869
4 SASI_Hs02_00365972 predicted 1727
5 SASI_Hs01_00201580 predicted 1124
6 SASI_Hs01_00201581 predicted 3115
7 SASI_Hs02_00365973 predicted 2881
8 SASI_Hs01_00201582 predicted 2457
9 SASI_Hs01_00201584 predicted 998
10 SASI_Hs01_00201586 predicted 1905
11 SASI_Hs01_00201583 predicted 1430
12 SASI_Hs01_00201585 predicted 2349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256219 predicted 883
2 SASI_Rn02_00256220 predicted 4094
3 SASI_Rn02_00256221 predicted 5039
4 SASI_Rn02_00256222 predicted 4373
5 SASI_Rn02_00256223 predicted 3020
6 SASI_Rn02_00256224 predicted 1406
7 SASI_Rn02_00256225 predicted 5793
8 SASI_Rn02_00256226 predicted 2566
9 SASI_Rn02_00256227 predicted 958
10 SASI_Rn02_00256228 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212840 predicted 864
2 SASI_Mm01_00212841 predicted 684
3 SASI_Mm01_00212842 predicted 1555
4 SASI_Mm01_00212843 predicted 2648
5 SASI_Mm02_00355560 predicted 450
6 SASI_Mm01_00212844 predicted 1499
7 SASI_Mm01_00212845 predicted 3114
8 SASI_Mm01_00212846 predicted 1545
9 SASI_Mm01_00212847 predicted 1846
10 SASI_Mm01_00212848 predicted 2665
11 SASI_Mm01_00212849 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436565 predicted 864
2 SASI_Mm02_00436566 predicted 680
3 SASI_Mm02_00436567 predicted 1556
4 SASI_Mm02_00436568 predicted 2642
5 SASI_Mm02_00436569 predicted 448
6 SASI_Mm02_00436570 predicted 1507
7 SASI_Mm02_00436571 predicted 3108
8 SASI_Mm02_00436572 predicted 1539
9 SASI_Mm02_00436573 predicted 1844
10 SASI_Mm02_00436574 predicted 2666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152348
WDR81 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 81
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-714s1c1
Sequence:CCGGGAACAGAAGATCCTCCTTGATCTCGAGATCAAGGAGGATCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1514s1c1
Sequence:CCGGGATGGCATACACAATCTACGTCTCGAGACGTAGATTGTGTATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152348.1-3156s1c1
Sequence:CCGGGAAGCGTTGCTACCTTCACTTCTCGAGAAGTGAAGGTAGCAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-2780s1c1
Sequence:CCGGGAAGCTCAGCTCTGAGAACTTCTCGAGAAGTTCTCAGAGCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-1508s1c1
Sequence:CCGGCCTGGAGATGGCATACACAATCTCGAGATTGTGTATGCCATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152348.1-3125s1c1
Sequence:CCGGCTCCTAGCAAGCAGGAAGTTACTCGAGTAACTTCCTGCTTGCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1103s1c1
Sequence:CCGGGACGCTGACTCAGAAGATCATCTCGAGATGATCTTCTGAGTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-701s1c1
Sequence:CCGGGTCAGAAGGCAAAGAACAGAACTCGAGTTCTGTTCTTTGCCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1109s1c1
Sequence:CCGGGACTCAGAAGATCATCGTGTACTCGAGTACACGATGATCTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152348
WDR81 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 81
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-714s1c1
Sequence:CCGGGAACAGAAGATCCTCCTTGATCTCGAGATCAAGGAGGATCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1514s1c1
Sequence:CCGGGATGGCATACACAATCTACGTCTCGAGACGTAGATTGTGTATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152348.1-3156s1c1
Sequence:CCGGGAAGCGTTGCTACCTTCACTTCTCGAGAAGTGAAGGTAGCAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-2780s1c1
Sequence:CCGGGAAGCTCAGCTCTGAGAACTTCTCGAGAAGTTCTCAGAGCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-1508s1c1
Sequence:CCGGCCTGGAGATGGCATACACAATCTCGAGATTGTGTATGCCATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152348.1-3125s1c1
Sequence:CCGGCTCCTAGCAAGCAGGAAGTTACTCGAGTAACTTCCTGCTTGCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1103s1c1
Sequence:CCGGGACGCTGACTCAGAAGATCATCTCGAGATGATCTTCTGAGTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-701s1c1
Sequence:CCGGGTCAGAAGGCAAAGAACAGAACTCGAGTTCTGTTCTTTGCCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1109s1c1
Sequence:CCGGGACTCAGAAGATCATCGTGTACTCGAGTACACGATGATCTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152348
WDR81 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 81
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-714s1c1
Sequence:CCGGGAACAGAAGATCCTCCTTGATCTCGAGATCAAGGAGGATCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1514s1c1
Sequence:CCGGGATGGCATACACAATCTACGTCTCGAGACGTAGATTGTGTATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152348.1-3156s1c1
Sequence:CCGGGAAGCGTTGCTACCTTCACTTCTCGAGAAGTGAAGGTAGCAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-2780s1c1
Sequence:CCGGGAAGCTCAGCTCTGAGAACTTCTCGAGAAGTTCTCAGAGCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-1508s1c1
Sequence:CCGGCCTGGAGATGGCATACACAATCTCGAGATTGTGTATGCCATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152348.1-3125s1c1
Sequence:CCGGCTCCTAGCAAGCAGGAAGTTACTCGAGTAACTTCCTGCTTGCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1103s1c1
Sequence:CCGGGACGCTGACTCAGAAGATCATCTCGAGATGATCTTCTGAGTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152348.1-701s1c1
Sequence:CCGGGTCAGAAGGCAAAGAACAGAACTCGAGTTCTGTTCTTTGCCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152348.1-1109s1c1
Sequence:CCGGGACTCAGAAGATCATCGTGTACTCGAGTACACGATGATCTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138950
VALIDATED
WDR81 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 81
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-963s21c1
Sequence:CCGGCTCTATGTGGTACACCCTTATCTCGAGATAAGGGTGTACCACATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138950.2-1457s21c1
Sequence:CCGGCTTCCGAGACCTTCGTAAATCCTCGAGGATTTACGAAGGTCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138950.2-6253s21c1
Sequence:CCGGTTCATGAAACTCGGGAGATACCTCGAGGTATCTCCCGAGTTTCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-726s21c1
Sequence:CCGGCGCCATGCATACCACACTTATCTCGAGATAAGTGTGGTATGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-2004s21c1
Sequence:CCGGTATGGCGTGGTACAGCTATTTCTCGAGAAATAGCTGTACCACGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138950
VALIDATED
WDR81 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 81
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-963s21c1
Sequence:CCGGCTCTATGTGGTACACCCTTATCTCGAGATAAGGGTGTACCACATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138950.2-1457s21c1
Sequence:CCGGCTTCCGAGACCTTCGTAAATCCTCGAGGATTTACGAAGGTCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138950.2-6253s21c1
Sequence:CCGGTTCATGAAACTCGGGAGATACCTCGAGGTATCTCCCGAGTTTCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-726s21c1
Sequence:CCGGCGCCATGCATACCACACTTATCTCGAGATAAGTGTGGTATGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-2004s21c1
Sequence:CCGGTATGGCGTGGTACAGCTATTTCTCGAGAAATAGCTGTACCACGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138950
VALIDATED
WDR81 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 81
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-963s21c1
Sequence:CCGGCTCTATGTGGTACACCCTTATCTCGAGATAAGGGTGTACCACATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138950.2-1457s21c1
Sequence:CCGGCTTCCGAGACCTTCGTAAATCCTCGAGGATTTACGAAGGTCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138950.2-6253s21c1
Sequence:CCGGTTCATGAAACTCGGGAGATACCTCGAGGTATCTCCCGAGTTTCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-726s21c1
Sequence:CCGGCGCCATGCATACCACACTTATCTCGAGATAAGTGTGGTATGCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138950.2-2004s21c1
Sequence:CCGGTATGGCGTGGTACAGCTATTTCTCGAGAAATAGCTGTACCACGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks