EMAIL THIS PAGE TO A FRIEND

WDR82

WD repeat domain 82

Synonyms: MST107 MSTP107 PRO2730 PRO34047 SWD2 TMEM113 WDR82A
UniProtKB ID: Q6UXN9, A8K5R5, Q8TEB2
Gene ID:
Human(80335) Summary: TMEM113 (WDR82) is a component of the mammalian SET1A (MIM 611052)/SET1B (MIM 611055) histone H3-Lys4 methyltransferase complexes (Lee and Skalnik, 2005 [PubMed 16253997]
Mouse(77305) WD repeat domain containing 82
Rat(686295) WD repeat domain 82
cow(783336) WD repeat domain 82
sheep(101112353) WD repeat domain 82
domestic guinea pig(100715444) WD repeat domain 82
naked mole-rat(101704836) WD repeat domain 82
fruit fly(34153) CG17293 gene product from transcript CG17293-RA
Zebrafish(321614) WD repeat domain containing 82
domestic cat(101081529) WD repeat domain 82
dog(484740) WD repeat domain 82
chicken(415942) WD repeat domain 82
231 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301144 ANTI-WDR82 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
HPA040427 Anti-WDR82 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025222 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025222 Rosetta Predictions human pricing
XM_001073342 Rosetta Predictions rat pricing
NM_029896 Rosetta Predictions mouse pricing
XM_135109 Rosetta Predictions mouse pricing
XM_898736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358014 predicted 829
2 SASI_Hs02_00358015 predicted 832
3 SASI_Hs02_00358016 predicted 578
4 SASI_Hs02_00358017 predicted 1273
5 SASI_Hs02_00358018 predicted 775
6 SASI_Hs02_00358019 predicted 1097
7 SASI_Hs02_00358020 predicted 533
8 SASI_Hs02_00358021 predicted 635
9 SASI_Hs02_00358022 predicted 508
10 SASI_Hs02_00358023 predicted 923
11 SASI_Hs01_00163116 predicted 1421
12 SASI_Hs01_00163117 predicted 1635
13 SASI_Hs01_00163118 predicted 1423
14 SASI_Hs01_00163119 predicted 1364
15 SASI_Hs01_00163120 predicted 1506
16 SASI_Hs01_00163121 predicted 1508
17 SASI_Hs01_00163122 predicted 1567
18 SASI_Hs01_00163123 predicted 1531
19 SASI_Hs01_00163124 predicted 1566
20 SASI_Hs01_00163125 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342443 predicted 1041
2 SASI_Rn02_00342444 predicted 786
3 SASI_Rn02_00342445 predicted 544
4 SASI_Rn02_00342446 predicted 914
5 SASI_Rn02_00342447 predicted 894
6 SASI_Rn02_00342448 predicted 1098
7 SASI_Rn02_00342449 predicted 845
8 SASI_Rn02_00342450 predicted 880
9 SASI_Rn02_00342451 predicted 952
10 SASI_Rn02_00342452 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336142 predicted 891
2 SASI_Mm02_00336143 predicted 1285
3 SASI_Mm02_00336144 predicted 751
4 SASI_Mm02_00336145 predicted 746
5 SASI_Mm02_00336146 predicted 834
6 SASI_Mm02_00336147 predicted 1132
7 SASI_Mm02_00336148 predicted 545
8 SASI_Mm02_00336149 predicted 1126
9 SASI_Mm02_00336150 predicted 645
10 SASI_Mm02_00336151 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233409 predicted 901
2 SASI_Mm01_00233410 predicted 1303
3 SASI_Mm01_00233411 predicted 795
4 SASI_Mm01_00233412 predicted 757
5 SASI_Mm01_00233413 predicted 757
6 SASI_Mm01_00233414 predicted 1142
7 SASI_Mm01_00233415 predicted 555
8 SASI_Mm01_00233416 predicted 1128
9 SASI_Mm01_00233417 predicted 890
10 SASI_Mm01_00233418 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216440 predicted 286
2 SASI_Mm01_00216441 predicted 683
3 SASI_Mm01_00216442 predicted 390
4 SASI_Mm01_00216443 predicted 514
5 SASI_Mm01_00216444 predicted 866
6 SASI_Mm01_00216445 predicted 256
7 SASI_Mm01_00216446 predicted 625
8 SASI_Mm01_00216447 predicted 873
9 SASI_Mm01_00216448 predicted 268
10 SASI_Mm01_00216449 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029896
VALIDATED
WDR82 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 82
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029896.1-1235s21c1
Sequence:CCGGCTGATGCTGCTGGGCTATTTACTCGAGTAAATAGCCCAGCAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-753s21c1
Sequence:CCGGTTTGATCCAGAAGGGTTAATTCTCGAGAATTAACCCTTCTGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-1088s21c1
Sequence:CCGGGAACGGAGAGAGTGGTATAAACTCGAGTTTATACCACTCTCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-509s21c1
Sequence:CCGGTGCAGCCAACACAGTCGTTTACTCGAGTAAACGACTGTGTTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-1012s21c1
Sequence:CCGGTGACACTCGAAGCTTCATTTACTCGAGTAAATGAAGCTTCGAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029896
VALIDATED
WDR82 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 82
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029896.1-1235s21c1
Sequence:CCGGCTGATGCTGCTGGGCTATTTACTCGAGTAAATAGCCCAGCAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-753s21c1
Sequence:CCGGTTTGATCCAGAAGGGTTAATTCTCGAGAATTAACCCTTCTGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-1088s21c1
Sequence:CCGGGAACGGAGAGAGTGGTATAAACTCGAGTTTATACCACTCTCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-509s21c1
Sequence:CCGGTGCAGCCAACACAGTCGTTTACTCGAGTAAACGACTGTGTTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-1012s21c1
Sequence:CCGGTGACACTCGAAGCTTCATTTACTCGAGTAAATGAAGCTTCGAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029896
VALIDATED
WDR82 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 82
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029896.1-1235s21c1
Sequence:CCGGCTGATGCTGCTGGGCTATTTACTCGAGTAAATAGCCCAGCAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-753s21c1
Sequence:CCGGTTTGATCCAGAAGGGTTAATTCTCGAGAATTAACCCTTCTGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-1088s21c1
Sequence:CCGGGAACGGAGAGAGTGGTATAAACTCGAGTTTATACCACTCTCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-509s21c1
Sequence:CCGGTGCAGCCAACACAGTCGTTTACTCGAGTAAACGACTGTGTTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029896.1-1012s21c1
Sequence:CCGGTGACACTCGAAGCTTCATTTACTCGAGTAAATGAAGCTTCGAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025222
VALIDATED
WDR82 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 82
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-1080s21c1
Sequence:CCGGGAATGGAGAGAGCGGTATAAACTCGAGTTTATACCGCTCTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2386s21c1
Sequence:CCGGGTTTCCAAGAGTTCAGCTGAACTCGAGTTCAGCTGAACTCTTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2360s21c1
Sequence:CCGGGCGTATGCATATATCTCTCATCTCGAGATGAGAGATATATGCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025222.3-745s21c1
Sequence:CCGGTTTGATCCAGAAGGGTTAATTCTCGAGAATTAACCCTTCTGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2512s21c1
Sequence:CCGGGAAGCAAAGCTGATAGTGTTTCTCGAGAAACACTATCAGCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1708s1c1
Sequence:CCGGGAAGACTGAAGCAAAGCTGATCTCGAGATCAGCTTTGCTTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1563s1c1
Sequence:CCGGGCGTATGCATATATCTCTCATCTCGAGATGAGAGATATATGCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1589s1c1
Sequence:CCGGGTTTCCAAGAGTTCAGCTGAACTCGAGTTCAGCTGAACTCTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025222.2-1718s1c1
Sequence:CCGGGCAAAGCTGATAGTGTTTGCTCTCGAGAGCAAACACTATCAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1715s1c1
Sequence:CCGGGAAGCAAAGCTGATAGTGTTTCTCGAGAAACACTATCAGCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-2348s1c1
Sequence:CCGGCGTACACCTTTCCCAAATGTACTCGAGTACATTTGGGAAAGGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025222
VALIDATED
WDR82 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 82
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-1080s21c1
Sequence:CCGGGAATGGAGAGAGCGGTATAAACTCGAGTTTATACCGCTCTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2386s21c1
Sequence:CCGGGTTTCCAAGAGTTCAGCTGAACTCGAGTTCAGCTGAACTCTTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2360s21c1
Sequence:CCGGGCGTATGCATATATCTCTCATCTCGAGATGAGAGATATATGCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025222.3-745s21c1
Sequence:CCGGTTTGATCCAGAAGGGTTAATTCTCGAGAATTAACCCTTCTGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2512s21c1
Sequence:CCGGGAAGCAAAGCTGATAGTGTTTCTCGAGAAACACTATCAGCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1708s1c1
Sequence:CCGGGAAGACTGAAGCAAAGCTGATCTCGAGATCAGCTTTGCTTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1563s1c1
Sequence:CCGGGCGTATGCATATATCTCTCATCTCGAGATGAGAGATATATGCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1589s1c1
Sequence:CCGGGTTTCCAAGAGTTCAGCTGAACTCGAGTTCAGCTGAACTCTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025222.2-1718s1c1
Sequence:CCGGGCAAAGCTGATAGTGTTTGCTCTCGAGAGCAAACACTATCAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1715s1c1
Sequence:CCGGGAAGCAAAGCTGATAGTGTTTCTCGAGAAACACTATCAGCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-2348s1c1
Sequence:CCGGCGTACACCTTTCCCAAATGTACTCGAGTACATTTGGGAAAGGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025222
VALIDATED
WDR82 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 82
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-1080s21c1
Sequence:CCGGGAATGGAGAGAGCGGTATAAACTCGAGTTTATACCGCTCTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2386s21c1
Sequence:CCGGGTTTCCAAGAGTTCAGCTGAACTCGAGTTCAGCTGAACTCTTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2360s21c1
Sequence:CCGGGCGTATGCATATATCTCTCATCTCGAGATGAGAGATATATGCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025222.3-745s21c1
Sequence:CCGGTTTGATCCAGAAGGGTTAATTCTCGAGAATTAACCCTTCTGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_025222.3-2512s21c1
Sequence:CCGGGAAGCAAAGCTGATAGTGTTTCTCGAGAAACACTATCAGCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1708s1c1
Sequence:CCGGGAAGACTGAAGCAAAGCTGATCTCGAGATCAGCTTTGCTTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1563s1c1
Sequence:CCGGGCGTATGCATATATCTCTCATCTCGAGATGAGAGATATATGCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1589s1c1
Sequence:CCGGGTTTCCAAGAGTTCAGCTGAACTCGAGTTCAGCTGAACTCTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025222.2-1718s1c1
Sequence:CCGGGCAAAGCTGATAGTGTTTGCTCTCGAGAGCAAACACTATCAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-1715s1c1
Sequence:CCGGGAAGCAAAGCTGATAGTGTTTCTCGAGAAACACTATCAGCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_025222.2-2348s1c1
Sequence:CCGGCGTACACCTTTCCCAAATGTACTCGAGTACATTTGGGAAAGGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks