EMAIL THIS PAGE TO A FRIEND

WDR83

WD repeat domain 83

Synonyms: MORG1
UniProtKB ID: Q9BRX9, B2RAF1, Q53FT6
Gene ID:
Human(84292) Summary: This gene encodes a member of the WD-40 protein family. The protein is proposed to function as a molecular scaffold for various multimeric protein complexes. The protein associates with several components of the extracellular signal-regulated kinase (ERK) pathway, and promotes ERK activity in response to serum or other signals. The protein also interacts with egl nine homolog 3 (EGLN3, also known as PHD3) and regulates expression of hypoxia-inducible factor 1, and has been purified as part of the spliceosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(67836) WD repeat domain containing 83
Rat(288924) WD repeat domain 83
Zebrafish(436702) WD repeat domain containing 83
domestic cat(101084089) WD repeat domain 83
dog(484931) WD repeat domain 83
naked mole-rat(101708669) WD repeat domain 83
domestic guinea pig(100731190) WD repeat domain 83
cow(780845) WD repeat domain 83
sheep(101107698) WD repeat domain 83
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099737 Rosetta Predictions human pricing
NM_032332 Rosetta Predictions human pricing
NM_001047847 Rosetta Predictions rat pricing
NM_026399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321223 predicted 848
2 SASI_Hs02_00321224 predicted 651
3 SASI_Hs02_00321225 predicted 1018
4 SASI_Hs02_00321226 predicted 1010
5 SASI_Hs02_00321227 predicted 699
6 SASI_Hs02_00321228 predicted 1094
7 SASI_Hs02_00321229 predicted 852
8 SASI_Hs02_00321230 predicted 711
9 SASI_Hs02_00321231 predicted 512
10 SASI_Hs02_00321232 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225655 predicted 607
2 SASI_Hs01_00225656 predicted 407
3 SASI_Hs01_00225657 predicted 772
4 SASI_Hs01_00225659 predicted 760
5 SASI_Hs01_00225660 predicted 448
6 SASI_Hs01_00225661 predicted 840
7 SASI_Hs01_00225662 predicted 611
8 SASI_Hs01_00225663 predicted 458
9 SASI_Hs01_00225664 predicted 266
10 SASI_Hs02_00359710 predicted 544
11 SASI_Hs01_00225658 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206145 predicted 700
2 SASI_Rn02_00206146 predicted 876
3 SASI_Rn02_00206147 predicted 336
4 SASI_Rn02_00206148 predicted 902
5 SASI_Rn02_00206149 predicted 742
6 SASI_Rn02_00206150 predicted 252
7 SASI_Rn02_00206151 predicted 600
8 SASI_Rn02_00206152 predicted 936
9 SASI_Rn02_00206153 predicted 609
10 SASI_Rn02_00206154 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179931 predicted 527
2 SASI_Mm01_00179932 predicted 854
3 SASI_Mm01_00179934 predicted 403
4 SASI_Mm02_00330176 predicted 747
5 SASI_Mm01_00179935 predicted 885
6 SASI_Mm01_00179936 predicted 761
7 SASI_Mm01_00179937 predicted 447
8 SASI_Mm01_00179938 predicted 670
9 SASI_Mm01_00179939 predicted 881
10 SASI_Mm01_00179940 predicted 525
11 SASI_Mm01_00179933 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032332
VALIDATED
WDR83 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 83
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-399s1c1
Sequence:CCGGCGGCTCTATTGATTCCAGTATCTCGAGATACTGGAATCAATAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-387s1c1
Sequence:CCGGAGTTATCCTGTCCGGCTCTATCTCGAGATAGAGCCGGACAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-546s1c1
Sequence:CCGGGAGACGCTATGACCTAAGGATCTCGAGATCCTTAGGTCATAGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-115s1c1
Sequence:CCGGCGATTTAATGTGGATGGCAATCTCGAGATTGCCATCCACATTAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-116s1c1
Sequence:CCGGGATTTAATGTGGATGGCAATTCTCGAGAATTGCCATCCACATTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-570s1c1
Sequence:CCGGGCAGCTCTTCTCAGACTACGTCTCGAGACGTAGTCTGAGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-702s1c1
Sequence:CCGGCGAGTACAAGGGCCATAAGAACTCGAGTTCTTATGGCCCTTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-355s1c1
Sequence:CCGGGTGAACACGGTGCAGTTTAATCTCGAGATTAAACTGCACCGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-170s21c1
Sequence:CCGGGTGCGAGCCGTACGATTTAATCTCGAGATTAAATCGTACGGCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-455s21c1
Sequence:CCGGGTTATCCTGTCCGGCTCTATTCTCGAGAATAGAGCCGGACAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-609s21c1
Sequence:CCGGGCGTGAGACGCTATGACCTAACTCGAGTTAGGTCATAGCGTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-423s21c1
Sequence:CCGGTGAACACGGTGCAGTTTAATGCTCGAGCATTAAACTGCACCGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-768s21c1
Sequence:CCGGGCGAGTACAAGGGCCATAAGACTCGAGTCTTATGGCCCTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032332
VALIDATED
WDR83 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 83
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-399s1c1
Sequence:CCGGCGGCTCTATTGATTCCAGTATCTCGAGATACTGGAATCAATAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-387s1c1
Sequence:CCGGAGTTATCCTGTCCGGCTCTATCTCGAGATAGAGCCGGACAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-546s1c1
Sequence:CCGGGAGACGCTATGACCTAAGGATCTCGAGATCCTTAGGTCATAGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-115s1c1
Sequence:CCGGCGATTTAATGTGGATGGCAATCTCGAGATTGCCATCCACATTAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-116s1c1
Sequence:CCGGGATTTAATGTGGATGGCAATTCTCGAGAATTGCCATCCACATTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-570s1c1
Sequence:CCGGGCAGCTCTTCTCAGACTACGTCTCGAGACGTAGTCTGAGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-702s1c1
Sequence:CCGGCGAGTACAAGGGCCATAAGAACTCGAGTTCTTATGGCCCTTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-355s1c1
Sequence:CCGGGTGAACACGGTGCAGTTTAATCTCGAGATTAAACTGCACCGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-170s21c1
Sequence:CCGGGTGCGAGCCGTACGATTTAATCTCGAGATTAAATCGTACGGCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-455s21c1
Sequence:CCGGGTTATCCTGTCCGGCTCTATTCTCGAGAATAGAGCCGGACAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-609s21c1
Sequence:CCGGGCGTGAGACGCTATGACCTAACTCGAGTTAGGTCATAGCGTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-423s21c1
Sequence:CCGGTGAACACGGTGCAGTTTAATGCTCGAGCATTAAACTGCACCGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-768s21c1
Sequence:CCGGGCGAGTACAAGGGCCATAAGACTCGAGTCTTATGGCCCTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032332
VALIDATED
WDR83 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 83
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-399s1c1
Sequence:CCGGCGGCTCTATTGATTCCAGTATCTCGAGATACTGGAATCAATAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-387s1c1
Sequence:CCGGAGTTATCCTGTCCGGCTCTATCTCGAGATAGAGCCGGACAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-546s1c1
Sequence:CCGGGAGACGCTATGACCTAAGGATCTCGAGATCCTTAGGTCATAGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-115s1c1
Sequence:CCGGCGATTTAATGTGGATGGCAATCTCGAGATTGCCATCCACATTAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_032332.2-116s1c1
Sequence:CCGGGATTTAATGTGGATGGCAATTCTCGAGAATTGCCATCCACATTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-570s1c1
Sequence:CCGGGCAGCTCTTCTCAGACTACGTCTCGAGACGTAGTCTGAGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-702s1c1
Sequence:CCGGCGAGTACAAGGGCCATAAGAACTCGAGTTCTTATGGCCCTTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032332.2-355s1c1
Sequence:CCGGGTGAACACGGTGCAGTTTAATCTCGAGATTAAACTGCACCGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-170s21c1
Sequence:CCGGGTGCGAGCCGTACGATTTAATCTCGAGATTAAATCGTACGGCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-455s21c1
Sequence:CCGGGTTATCCTGTCCGGCTCTATTCTCGAGAATAGAGCCGGACAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-609s21c1
Sequence:CCGGGCGTGAGACGCTATGACCTAACTCGAGTTAGGTCATAGCGTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-423s21c1
Sequence:CCGGTGAACACGGTGCAGTTTAATGCTCGAGCATTAAACTGCACCGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032332.3-768s21c1
Sequence:CCGGGCGAGTACAAGGGCCATAAGACTCGAGTCTTATGGCCCTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026399
VALIDATED
WDR83 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 83
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026399.2-224s1c1
Sequence:CCGGGCGATTTAATGTGGACGGCAACTCGAGTTGCCGTCCACATTAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-951s1c1
Sequence:CCGGCCTGTGGGTTCTAATGTGGTACTCGAGTACCACATTAGAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-589s1c1
Sequence:CCGGGAGACGGCATATCCAGTGTAACTCGAGTTACACTGGATATGCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-824s1c1
Sequence:CCGGCCATAAGAACCAGCAGTACAACTCGAGTTGTACTGCTGGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-564s1c1
Sequence:CCGGCCGGTGCAAACACTAGATGAACTCGAGTTCATCTAGTGTTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-213s21c1
Sequence:CCGGGTGCGAGCCGTGCGATTTAATCTCGAGATTAAATCGCACGGCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-951s21c1
Sequence:CCGGCCTGTGGGTTCTAATGTGGTACTCGAGTACCACATTAGAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-589s21c1
Sequence:CCGGGAGACGGCATATCCAGTGTAACTCGAGTTACACTGGATATGCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-824s21c1
Sequence:CCGGCCATAAGAACCAGCAGTACAACTCGAGTTGTACTGCTGGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-564s21c1
Sequence:CCGGCCGGTGCAAACACTAGATGAACTCGAGTTCATCTAGTGTTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026399
VALIDATED
WDR83 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 83
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026399.2-224s1c1
Sequence:CCGGGCGATTTAATGTGGACGGCAACTCGAGTTGCCGTCCACATTAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-951s1c1
Sequence:CCGGCCTGTGGGTTCTAATGTGGTACTCGAGTACCACATTAGAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-589s1c1
Sequence:CCGGGAGACGGCATATCCAGTGTAACTCGAGTTACACTGGATATGCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-824s1c1
Sequence:CCGGCCATAAGAACCAGCAGTACAACTCGAGTTGTACTGCTGGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-564s1c1
Sequence:CCGGCCGGTGCAAACACTAGATGAACTCGAGTTCATCTAGTGTTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-213s21c1
Sequence:CCGGGTGCGAGCCGTGCGATTTAATCTCGAGATTAAATCGCACGGCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-951s21c1
Sequence:CCGGCCTGTGGGTTCTAATGTGGTACTCGAGTACCACATTAGAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-589s21c1
Sequence:CCGGGAGACGGCATATCCAGTGTAACTCGAGTTACACTGGATATGCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-824s21c1
Sequence:CCGGCCATAAGAACCAGCAGTACAACTCGAGTTGTACTGCTGGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-564s21c1
Sequence:CCGGCCGGTGCAAACACTAGATGAACTCGAGTTCATCTAGTGTTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026399
VALIDATED
WDR83 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 83
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026399.2-224s1c1
Sequence:CCGGGCGATTTAATGTGGACGGCAACTCGAGTTGCCGTCCACATTAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-951s1c1
Sequence:CCGGCCTGTGGGTTCTAATGTGGTACTCGAGTACCACATTAGAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-589s1c1
Sequence:CCGGGAGACGGCATATCCAGTGTAACTCGAGTTACACTGGATATGCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-824s1c1
Sequence:CCGGCCATAAGAACCAGCAGTACAACTCGAGTTGTACTGCTGGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026399.2-564s1c1
Sequence:CCGGCCGGTGCAAACACTAGATGAACTCGAGTTCATCTAGTGTTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-213s21c1
Sequence:CCGGGTGCGAGCCGTGCGATTTAATCTCGAGATTAAATCGCACGGCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-951s21c1
Sequence:CCGGCCTGTGGGTTCTAATGTGGTACTCGAGTACCACATTAGAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-589s21c1
Sequence:CCGGGAGACGGCATATCCAGTGTAACTCGAGTTACACTGGATATGCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-824s21c1
Sequence:CCGGCCATAAGAACCAGCAGTACAACTCGAGTTGTACTGCTGGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026399.2-564s21c1
Sequence:CCGGCCGGTGCAAACACTAGATGAACTCGAGTTCATCTAGTGTTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks