EMAIL THIS PAGE TO A FRIEND

WDR83OS

WD repeat domain 83 opposite strand

Synonyms: C19orf56 PTD008
UniProtKB ID: Q9Y284, B2R4T8, Q9BVI3
Gene ID:
Rat(288925) WD repeat domain 83 opposite strand
cow(508733) WD repeat domain 83 opposite strand
sheep(101107958) WD repeat domain 83 opposite strand
domestic guinea pig(100717923) WD repeat domain 83 opposite strand
naked mole-rat(101709033) WD repeat domain 83 opposite strand
domestic cat(101083404) WD repeat domain 83 opposite strand
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016145 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016145 Rosetta Predictions human pricing
NM_001105947 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348940 predicted 496
2 SASI_Hs01_00239555 predicted 359
3 SASI_Hs02_00348941 predicted 482
4 SASI_Hs01_00239557 predicted 363
5 SASI_Hs02_00348942 predicted 609
6 SASI_Hs01_00239559 predicted 548
7 SASI_Hs01_00239560 predicted 602
8 SASI_Hs01_00239561 predicted 374
9 SASI_Hs02_00348943 predicted 324
10 SASI_Hs02_00348944 predicted 558
11 SASI_Hs01_00239552 predicted 397
12 SASI_Hs01_00239553 predicted 461
13 SASI_Hs01_00239554 predicted 465
14 SASI_Hs01_00239556 predicted 456
15 SASI_Hs01_00239558 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214112 predicted 222
2 SASI_Rn02_00214113 predicted 301
3 SASI_Rn02_00214114 predicted 367
4 SASI_Rn02_00214115 predicted 217
5 SASI_Rn02_00214116 predicted 352
6 SASI_Rn02_00214117 predicted 216
7 SASI_Rn02_00214118 predicted 278
8 SASI_Rn02_00214119 predicted 311
9 SASI_Rn02_00214120 predicted 283
10 SASI_Rn02_00214121 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016145
WDR83OS MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 83 opposite strand
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-347s21c1
Sequence:CCGGGCCGGACTACATGAACCTGCTCTCGAGAGCAGGTTCATGTAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-281s21c1
Sequence:CCGGGCCGAACAAAGTGCTGAGGTACTCGAGTACCTCAGCACTTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-491s21c1
Sequence:CCGGGAGTAGCTTCATGCTGTCCATCTCGAGATGGACAGCATGAAGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-482s21c1
Sequence:CCGGGCAAATGATGAGTAGCTTCATCTCGAGATGAAGCTACTCATCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-468s1c1
Sequence:CCGGCAAATGATGAGTAGCTTCATGCTCGAGCATGAAGCTACTCATCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-268s1c1
Sequence:CCGGCGAACAAAGTGCTGAGGTACACTCGAGTGTACCTCAGCACTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-476s1c1
Sequence:CCGGGAGTAGCTTCATGCTGTCCATCTCGAGATGGACAGCATGAAGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-463s1c1
Sequence:CCGGCGAAGCAAATGATGAGTAGCTCTCGAGAGCTACTCATCATTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-269s1c1
Sequence:CCGGGAACAAAGTGCTGAGGTACAACTCGAGTTGTACCTCAGCACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-332s1c1
Sequence:CCGGGCCGGACTACATGAACCTGCTCTCGAGAGCAGGTTCATGTAGTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-266s1c1
Sequence:CCGGGCCGAACAAAGTGCTGAGGTACTCGAGTACCTCAGCACTTTGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-467s1c1
Sequence:CCGGGCAAATGATGAGTAGCTTCATCTCGAGATGAAGCTACTCATCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016145
WDR83OS MISSION shRNA shRNA Plasmid DNA
WD repeat domain 83 opposite strand
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-347s21c1
Sequence:CCGGGCCGGACTACATGAACCTGCTCTCGAGAGCAGGTTCATGTAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-281s21c1
Sequence:CCGGGCCGAACAAAGTGCTGAGGTACTCGAGTACCTCAGCACTTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-491s21c1
Sequence:CCGGGAGTAGCTTCATGCTGTCCATCTCGAGATGGACAGCATGAAGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-482s21c1
Sequence:CCGGGCAAATGATGAGTAGCTTCATCTCGAGATGAAGCTACTCATCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-468s1c1
Sequence:CCGGCAAATGATGAGTAGCTTCATGCTCGAGCATGAAGCTACTCATCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-268s1c1
Sequence:CCGGCGAACAAAGTGCTGAGGTACACTCGAGTGTACCTCAGCACTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-476s1c1
Sequence:CCGGGAGTAGCTTCATGCTGTCCATCTCGAGATGGACAGCATGAAGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-463s1c1
Sequence:CCGGCGAAGCAAATGATGAGTAGCTCTCGAGAGCTACTCATCATTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-269s1c1
Sequence:CCGGGAACAAAGTGCTGAGGTACAACTCGAGTTGTACCTCAGCACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-332s1c1
Sequence:CCGGGCCGGACTACATGAACCTGCTCTCGAGAGCAGGTTCATGTAGTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-266s1c1
Sequence:CCGGGCCGAACAAAGTGCTGAGGTACTCGAGTACCTCAGCACTTTGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-467s1c1
Sequence:CCGGGCAAATGATGAGTAGCTTCATCTCGAGATGAAGCTACTCATCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016145
WDR83OS MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 83 opposite strand
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-347s21c1
Sequence:CCGGGCCGGACTACATGAACCTGCTCTCGAGAGCAGGTTCATGTAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-281s21c1
Sequence:CCGGGCCGAACAAAGTGCTGAGGTACTCGAGTACCTCAGCACTTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-491s21c1
Sequence:CCGGGAGTAGCTTCATGCTGTCCATCTCGAGATGGACAGCATGAAGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016145.3-482s21c1
Sequence:CCGGGCAAATGATGAGTAGCTTCATCTCGAGATGAAGCTACTCATCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-468s1c1
Sequence:CCGGCAAATGATGAGTAGCTTCATGCTCGAGCATGAAGCTACTCATCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-268s1c1
Sequence:CCGGCGAACAAAGTGCTGAGGTACACTCGAGTGTACCTCAGCACTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-476s1c1
Sequence:CCGGGAGTAGCTTCATGCTGTCCATCTCGAGATGGACAGCATGAAGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-463s1c1
Sequence:CCGGCGAAGCAAATGATGAGTAGCTCTCGAGAGCTACTCATCATTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016145.1-269s1c1
Sequence:CCGGGAACAAAGTGCTGAGGTACAACTCGAGTTGTACCTCAGCACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-332s1c1
Sequence:CCGGGCCGGACTACATGAACCTGCTCTCGAGAGCAGGTTCATGTAGTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-266s1c1
Sequence:CCGGGCCGAACAAAGTGCTGAGGTACTCGAGTACCTCAGCACTTTGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016145.1-467s1c1
Sequence:CCGGGCAAATGATGAGTAGCTTCATCTCGAGATGAAGCTACTCATCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks