EMAIL THIS PAGE TO A FRIEND

WDR86

WD repeat domain 86

UniProtKB ID: Q86TI4, Q3KNT1, Q6ZUS8
Gene ID:
Mouse(269633) WD repeat domain 86
Rat(311956) WD repeat domain 86
cow(100140069) WD repeat domain 86
sheep(101115118) WD repeat domain 86
naked mole-rat(101702829) WD repeat domain 86
domestic guinea pig(100715035) WD repeat domain 86
chicken(770203) WD repeat domain 86
domestic cat(101082895) WD repeat domain 86
dog(475544) WD repeat domain 86
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198285 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172001 MISSION® esiRNA esiRNA targeting mouse Wdr86 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198285 Rosetta Predictions human pricing
NM_001110489 Rosetta Predictions rat pricing
NM_001081441 Rosetta Predictions mouse pricing
NM_026621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371848 predicted 727
2 SASI_Hs02_00371849 predicted 737
3 SASI_Hs02_00371850 predicted 1242
4 SASI_Hs02_00371851 predicted 851
5 SASI_Hs02_00371852 predicted 724
6 SASI_Hs02_00371853 predicted 1272
7 SASI_Hs02_00371854 predicted 1388
8 SASI_Hs02_00371855 predicted 620
9 SASI_Hs02_00371856 predicted 1271
10 SASI_Hs01_00223860 predicted 966
11 SASI_Hs01_00223853 predicted 314
12 SASI_Hs01_00223854 predicted 641
13 SASI_Hs01_00223855 predicted 1024
14 SASI_Hs01_00223856 predicted 654
15 SASI_Hs01_00223857 predicted 840
16 SASI_Hs01_00223858 predicted 664
17 SASI_Hs01_00223859 predicted 653
18 SASI_Hs01_00223861 predicted 832
19 SASI_Hs01_00223862 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251242 predicted 448
2 SASI_Rn02_00251243 predicted 416
3 SASI_Rn02_00251244 predicted 1347
4 SASI_Rn02_00251245 predicted 1176
5 SASI_Rn02_00251246 predicted 485
6 SASI_Rn02_00251247 predicted 1321
7 SASI_Rn02_00251248 predicted 1243
8 SASI_Rn02_00251249 predicted 1234
9 SASI_Rn02_00251250 predicted 1291
10 SASI_Rn02_00251251 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298381 predicted 1535
2 SASI_Mm02_00298382 predicted 1266
3 SASI_Mm02_00298383 predicted 845
4 SASI_Mm02_00298384 predicted 828
5 SASI_Mm02_00298385 predicted 591
6 SASI_Mm02_00298386 predicted 1154
7 SASI_Mm02_00298387 predicted 1045
8 SASI_Mm02_00298388 predicted 617
9 SASI_Mm02_00298389 predicted 503
10 SASI_Mm02_00298390 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101746 predicted 294
2 SASI_Mm01_00101747 predicted 299
3 SASI_Mm01_00101748 predicted 334
4 SASI_Mm01_00101749 predicted 272
5 SASI_Mm01_00101750 predicted 287
6 SASI_Mm01_00101751 predicted 297
7 SASI_Mm01_00101752 predicted 300
8 SASI_Mm01_00101753 predicted 273
9 SASI_Mm01_00101754 predicted 301
10 SASI_Mm01_00101755 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026621
WDR86 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 86
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026621.1-305s1c1
Sequence:CCGGCATGACCTTTCCCAATGTGGACTCGAGTCCACATTGGGAAAGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-315s1c1
Sequence:CCGGCCCAATGTGGAGGAAGAAACACTCGAGTGTTTCTTCCTCCACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-360s1c1
Sequence:CCGGCAAGGCTTTGCTACTTGGGATCTCGAGATCCCAAGTAGCAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026621.1-365s1c1
Sequence:CCGGCTTTGCTACTTGGGATACTTCCTCGAGGAAGTATCCCAAGTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-187s1c1
Sequence:CCGGCTCACGCCTCTTTAGCAACAACTCGAGTTGTTGCTAAAGAGGCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-364s1c1
Sequence:CCGGGCTTTGCTACTTGGGATACTTCTCGAGAAGTATCCCAAGTAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026621
WDR86 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 86
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026621.1-305s1c1
Sequence:CCGGCATGACCTTTCCCAATGTGGACTCGAGTCCACATTGGGAAAGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-315s1c1
Sequence:CCGGCCCAATGTGGAGGAAGAAACACTCGAGTGTTTCTTCCTCCACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-360s1c1
Sequence:CCGGCAAGGCTTTGCTACTTGGGATCTCGAGATCCCAAGTAGCAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026621.1-365s1c1
Sequence:CCGGCTTTGCTACTTGGGATACTTCCTCGAGGAAGTATCCCAAGTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-187s1c1
Sequence:CCGGCTCACGCCTCTTTAGCAACAACTCGAGTTGTTGCTAAAGAGGCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-364s1c1
Sequence:CCGGGCTTTGCTACTTGGGATACTTCTCGAGAAGTATCCCAAGTAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026621
WDR86 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 86
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026621.1-305s1c1
Sequence:CCGGCATGACCTTTCCCAATGTGGACTCGAGTCCACATTGGGAAAGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-315s1c1
Sequence:CCGGCCCAATGTGGAGGAAGAAACACTCGAGTGTTTCTTCCTCCACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-360s1c1
Sequence:CCGGCAAGGCTTTGCTACTTGGGATCTCGAGATCCCAAGTAGCAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026621.1-365s1c1
Sequence:CCGGCTTTGCTACTTGGGATACTTCCTCGAGGAAGTATCCCAAGTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-187s1c1
Sequence:CCGGCTCACGCCTCTTTAGCAACAACTCGAGTTGTTGCTAAAGAGGCGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026621.1-364s1c1
Sequence:CCGGGCTTTGCTACTTGGGATACTTCTCGAGAAGTATCCCAAGTAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198285
WDR86 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 86
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-701s1c1
Sequence:CCGGGCCACACATTCATCATCAACTCTCGAGAGTTGATGATGAATGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-482s1c1
Sequence:CCGGGCAGTGCTGTGCCTAGTGCTACTCGAGTAGCACTAGGCACAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-1027s1c1
Sequence:CCGGCCCGTCGCAGGCGTCTGGTTTCTCGAGAAACCAGACGCCTGCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-313s1c1
Sequence:CCGGCTGCGTGCTGACCCTAGCCTACTCGAGTAGGCTAGGGTCAGCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-837s1c1
Sequence:CCGGCTCGCGGCTCTTCAGCAACAACTCGAGTTGTTGCTGAAGAGCCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-601s21c1
Sequence:CCGGCGCTCCTGCAAGGACATGAAACTCGAGTTTCATGTCCTTGCAGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-733s21c1
Sequence:CCGGGACACACGTCCATCGTGAACACTCGAGTGTTCACGATGGACGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-1177s21c1
Sequence:CCGGTGGTGAACCGACTCGTGTACTCTCGAGAGTACACGAGTCGGTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198285
WDR86 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 86
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-701s1c1
Sequence:CCGGGCCACACATTCATCATCAACTCTCGAGAGTTGATGATGAATGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-482s1c1
Sequence:CCGGGCAGTGCTGTGCCTAGTGCTACTCGAGTAGCACTAGGCACAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-1027s1c1
Sequence:CCGGCCCGTCGCAGGCGTCTGGTTTCTCGAGAAACCAGACGCCTGCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-313s1c1
Sequence:CCGGCTGCGTGCTGACCCTAGCCTACTCGAGTAGGCTAGGGTCAGCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-837s1c1
Sequence:CCGGCTCGCGGCTCTTCAGCAACAACTCGAGTTGTTGCTGAAGAGCCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-601s21c1
Sequence:CCGGCGCTCCTGCAAGGACATGAAACTCGAGTTTCATGTCCTTGCAGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-733s21c1
Sequence:CCGGGACACACGTCCATCGTGAACACTCGAGTGTTCACGATGGACGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-1177s21c1
Sequence:CCGGTGGTGAACCGACTCGTGTACTCTCGAGAGTACACGAGTCGGTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198285
WDR86 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 86
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-701s1c1
Sequence:CCGGGCCACACATTCATCATCAACTCTCGAGAGTTGATGATGAATGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-482s1c1
Sequence:CCGGGCAGTGCTGTGCCTAGTGCTACTCGAGTAGCACTAGGCACAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-1027s1c1
Sequence:CCGGCCCGTCGCAGGCGTCTGGTTTCTCGAGAAACCAGACGCCTGCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-313s1c1
Sequence:CCGGCTGCGTGCTGACCCTAGCCTACTCGAGTAGGCTAGGGTCAGCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198285.1-837s1c1
Sequence:CCGGCTCGCGGCTCTTCAGCAACAACTCGAGTTGTTGCTGAAGAGCCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-601s21c1
Sequence:CCGGCGCTCCTGCAAGGACATGAAACTCGAGTTTCATGTCCTTGCAGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-733s21c1
Sequence:CCGGGACACACGTCCATCGTGAACACTCGAGTGTTCACGATGGACGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198285.2-1177s21c1
Sequence:CCGGTGGTGAACCGACTCGTGTACTCTCGAGAGTACACGAGTCGGTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks