EMAIL THIS PAGE TO A FRIEND

WDR87

WD repeat domain 87

Synonyms: NYD-SP11
UniProtKB ID: Q6ZQQ6, Q9BWV9
Gene ID:
Rat(687472) WD repeat domain 87
Horse(100146190) WD repeat domain 87
dog(612600) WD repeat domain 87
domestic guinea pig(100725102) WD repeat domain 87
cow(509804) WD repeat domain 87
sheep(101109732) WD repeat domain 87
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031951 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717392 Rosetta Predictions human pricing
XM_371164 Rosetta Predictions human pricing
XM_940478 Rosetta Predictions human pricing
XM_001078719 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416948 predicted 3132
2 SASI_Hs02_00416949 predicted 1007
3 SASI_Hs02_00416950 predicted 1308
4 SASI_Hs02_00416951 predicted 2588
5 SASI_Hs02_00416952 predicted 4114
6 SASI_Hs02_00416953 predicted 8097
7 SASI_Hs02_00416954 predicted 3303
8 SASI_Hs02_00416955 predicted 765
9 SASI_Hs02_00416956 predicted 1521
10 SASI_Hs02_00416957 predicted 3844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479289 predicted 3132
2 SASI_Hs01_00295738 predicted 1007
3 SASI_Hs01_00295740 predicted 1301
4 SASI_Hs01_00295741 predicted 2589
5 SASI_Hs01_00295742 predicted 4109
6 SASI_Hs01_00295743 predicted 8104
7 SASI_Hs02_00479290 predicted 3305
8 SASI_Hs01_00295744 predicted 761
9 SASI_Hs01_00295745 predicted 1520
10 SASI_Hs02_00479291 predicted 3852
11 SASI_Hs01_00295739 predicted 264
12 SASI_Hs01_00295746 predicted 1678
13 SASI_Hs01_00295747 predicted 4474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484234 predicted 3136
2 SASI_Hs02_00484235 predicted 1009
3 SASI_Hs02_00484236 predicted 3408
4 SASI_Hs02_00484237 predicted 1301
5 SASI_Hs02_00484238 predicted 2588
6 SASI_Hs02_00484239 predicted 4112
7 SASI_Hs02_00484240 predicted 3307
8 SASI_Hs02_00484241 predicted 760
9 SASI_Hs02_00484242 predicted 1513
10 SASI_Hs02_00484243 predicted 3844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361799 predicted 1331
2 SASI_Rn02_00361800 predicted 1872
3 SASI_Rn02_00361801 predicted 650
4 SASI_Rn02_00361802 predicted 616
5 SASI_Rn02_00361803 predicted 1074
6 SASI_Rn02_00361804 predicted 408
7 SASI_Rn02_00361805 predicted 773
8 SASI_Rn02_00361806 predicted 1423
9 SASI_Rn02_00361807 predicted 282
10 SASI_Rn02_00361808 predicted 1328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031951
WDR87 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 87
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-2844s21c1
Sequence:CCGGGATGAGTGAAATAACCATTAACTCGAGTTAATGGTTATTTCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-1522s21c1
Sequence:CCGGGGTCTAGAGGGACTGATATTCCTCGAGGAATATCAGTCCCTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-8496s21c1
Sequence:CCGGCATGGACCTGTACCAACTTAACTCGAGTTAAGTTGGTACAGGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-2390s21c1
Sequence:CCGGTGCGTTCCTCCATGCATTATTCTCGAGAATAATGCATGGAGGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-271s21c1
Sequence:CCGGCTCCTAAATGACACCATAAATCTCGAGATTTATGGTGTCATTTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031951
WDR87 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 87
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-2844s21c1
Sequence:CCGGGATGAGTGAAATAACCATTAACTCGAGTTAATGGTTATTTCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-1522s21c1
Sequence:CCGGGGTCTAGAGGGACTGATATTCCTCGAGGAATATCAGTCCCTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-8496s21c1
Sequence:CCGGCATGGACCTGTACCAACTTAACTCGAGTTAAGTTGGTACAGGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-2390s21c1
Sequence:CCGGTGCGTTCCTCCATGCATTATTCTCGAGAATAATGCATGGAGGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-271s21c1
Sequence:CCGGCTCCTAAATGACACCATAAATCTCGAGATTTATGGTGTCATTTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031951
WDR87 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 87
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-2844s21c1
Sequence:CCGGGATGAGTGAAATAACCATTAACTCGAGTTAATGGTTATTTCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-1522s21c1
Sequence:CCGGGGTCTAGAGGGACTGATATTCCTCGAGGAATATCAGTCCCTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-8496s21c1
Sequence:CCGGCATGGACCTGTACCAACTTAACTCGAGTTAAGTTGGTACAGGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-2390s21c1
Sequence:CCGGTGCGTTCCTCCATGCATTATTCTCGAGAATAATGCATGGAGGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031951.3-271s21c1
Sequence:CCGGCTCCTAAATGACACCATAAATCTCGAGATTTATGGTGTCATTTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks