EMAIL THIS PAGE TO A FRIEND

WDR88

WD repeat domain 88

Synonyms: PQWD
UniProtKB ID: Q6ZMY6, Q8NEF8
Gene ID:
Mouse(384605) WD repeat domain 88
Rat(292809) WD repeat domain 88
cow(518737) WD repeat domain 88
sheep(101117783) WD repeat domain 88
domestic guinea pig(100730620) WD repeat domain 88
naked mole-rat(101726698) WD repeat domain 88
chicken(769046) WD repeat domain 88
Horse(100056243) WD repeat domain 88
domestic cat(101083638) WD repeat domain 88
chicken(101665851) WD repeat domain 88
chicken(101752101) WD repeat domain 88
dog(476494) WD repeat domain 88
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173479 Rosetta Predictions human pricing
XM_001079689 Rosetta Predictions rat pricing
XM_218509 Rosetta Predictions rat pricing
XM_001480144 Rosetta Predictions mouse pricing
XM_357739 Rosetta Predictions mouse pricing
XR_003943 Rosetta Predictions mouse pricing
XR_005033 Rosetta Predictions mouse pricing
XR_035588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152973 predicted 1322
2 SASI_Hs01_00152974 predicted 1416
3 SASI_Hs01_00152975 predicted 552
4 SASI_Hs01_00152976 predicted 625
5 SASI_Hs02_00368237 predicted 1273
6 SASI_Hs01_00152977 predicted 1157
7 SASI_Hs01_00152978 predicted 516
8 SASI_Hs01_00152979 predicted 1418
9 SASI_Hs01_00152980 predicted 401
10 SASI_Hs01_00152981 predicted 1262
11 SASI_Hs01_00152982 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365114 predicted 1040
2 SASI_Rn02_00365115 predicted 477
3 SASI_Rn02_00365116 predicted 618
4 SASI_Rn02_00365117 predicted 812
5 SASI_Rn02_00365118 predicted 1319
6 SASI_Rn02_00365119 predicted 1158
7 SASI_Rn02_00365120 predicted 747
8 SASI_Rn02_00365121 predicted 888
9 SASI_Rn02_00365122 predicted 849
10 SASI_Rn02_00365123 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377823 predicted 471
2 SASI_Rn02_00377824 predicted 693
3 SASI_Rn02_00377825 predicted 638
4 SASI_Rn02_00377826 predicted 310
5 SASI_Rn02_00377827 predicted 555
6 SASI_Rn02_00377828 predicted 541
7 SASI_Rn02_00377829 predicted 381
8 SASI_Rn02_00377830 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00415347 predicted 1000
2 SASI_Mm02_00415348 predicted 700
3 SASI_Mm02_00415349 predicted 848
4 SASI_Mm02_00415350 predicted 584
5 SASI_Mm02_00415351 predicted 989
6 SASI_Mm02_00415352 predicted 1124
7 SASI_Mm02_00415353 predicted 584
8 SASI_Mm02_00415354 predicted 703
9 SASI_Mm02_00415355 predicted 1186
10 SASI_Mm02_00415356 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267228 predicted 1009
2 SASI_Mm01_00267229 predicted 542
3 SASI_Mm01_00267230 predicted 858
4 SASI_Mm01_00267231 predicted 511
5 SASI_Mm01_00267232 predicted 842
6 SASI_Mm01_00267233 predicted 963
7 SASI_Mm01_00267234 predicted 587
8 SASI_Mm01_00267235 predicted 997
9 SASI_Mm01_00267236 predicted 779
10 SASI_Mm01_00267237 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_003943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225076 predicted 1003
2 SASI_Mm01_00225077 predicted 541
3 SASI_Mm01_00225078 predicted 861
4 SASI_Mm01_00225079 predicted 508
5 SASI_Mm01_00225080 predicted 841
6 SASI_Mm01_00225081 predicted 965
7 SASI_Mm01_00225082 predicted 581
8 SASI_Mm01_00225083 predicted 998
9 SASI_Mm01_00225084 predicted 783
10 SASI_Mm01_00225085 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283199 predicted 1001
2 SASI_Mm01_00283200 predicted 543
3 SASI_Mm01_00283201 predicted 860
4 SASI_Mm01_00283202 predicted 510
5 SASI_Mm01_00283203 predicted 849
6 SASI_Mm01_00283204 predicted 957
7 SASI_Mm01_00283205 predicted 583
8 SASI_Mm01_00283206 predicted 999
9 SASI_Mm01_00283207 predicted 779
10 SASI_Mm01_00283208 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00483379 predicted 996
2 SASI_Mm02_00483380 predicted 706
3 SASI_Mm02_00483381 predicted 1772
4 SASI_Mm02_00483382 predicted 852
5 SASI_Mm02_00483383 predicted 1779
6 SASI_Mm02_00483384 predicted 1064
7 SASI_Mm02_00483385 predicted 581
8 SASI_Mm02_00483386 predicted 993
9 SASI_Mm02_00483387 predicted 1116
10 SASI_Mm02_00483388 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173479
WDR88 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 88
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-699s21c1
Sequence:CCGGGGATCATGGAATCTGCATAATCTCGAGATTATGCAGATTCCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-1235s21c1
Sequence:CCGGCCATGAGACTGTGGAATATTGCTCGAGCAATATTCCACAGTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-1101s21c1
Sequence:CCGGTGATAGGACTGTGGCTATTTGCTCGAGCAAATAGCCACAGTCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-558s1c1
Sequence:CCGGCATTGCCGCATCCTATGATAACTCGAGTTATCATAGGATGCGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1147s1c1
Sequence:CCGGCTCTCTTTGAAGGGCCATAATCTCGAGATTATGGCCCTTCAAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-724s1c1
Sequence:CCGGGCCGAGAACATCACCACCGTTCTCGAGAACGGTGGTGATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1034s1c1
Sequence:CCGGGCCATGAAGGTTCTGTCAGTTCTCGAGAACTGACAGAACCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1273s1c1
Sequence:CCGGCCTTTGGTAATCAAGTACAAACTCGAGTTTGTACTTGATTACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173479
WDR88 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 88
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-699s21c1
Sequence:CCGGGGATCATGGAATCTGCATAATCTCGAGATTATGCAGATTCCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-1235s21c1
Sequence:CCGGCCATGAGACTGTGGAATATTGCTCGAGCAATATTCCACAGTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-1101s21c1
Sequence:CCGGTGATAGGACTGTGGCTATTTGCTCGAGCAAATAGCCACAGTCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-558s1c1
Sequence:CCGGCATTGCCGCATCCTATGATAACTCGAGTTATCATAGGATGCGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1147s1c1
Sequence:CCGGCTCTCTTTGAAGGGCCATAATCTCGAGATTATGGCCCTTCAAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-724s1c1
Sequence:CCGGGCCGAGAACATCACCACCGTTCTCGAGAACGGTGGTGATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1034s1c1
Sequence:CCGGGCCATGAAGGTTCTGTCAGTTCTCGAGAACTGACAGAACCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1273s1c1
Sequence:CCGGCCTTTGGTAATCAAGTACAAACTCGAGTTTGTACTTGATTACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173479
WDR88 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 88
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-699s21c1
Sequence:CCGGGGATCATGGAATCTGCATAATCTCGAGATTATGCAGATTCCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-1235s21c1
Sequence:CCGGCCATGAGACTGTGGAATATTGCTCGAGCAATATTCCACAGTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173479.3-1101s21c1
Sequence:CCGGTGATAGGACTGTGGCTATTTGCTCGAGCAAATAGCCACAGTCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-558s1c1
Sequence:CCGGCATTGCCGCATCCTATGATAACTCGAGTTATCATAGGATGCGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1147s1c1
Sequence:CCGGCTCTCTTTGAAGGGCCATAATCTCGAGATTATGGCCCTTCAAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-724s1c1
Sequence:CCGGGCCGAGAACATCACCACCGTTCTCGAGAACGGTGGTGATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1034s1c1
Sequence:CCGGGCCATGAAGGTTCTGTCAGTTCTCGAGAACTGACAGAACCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173479.1-1273s1c1
Sequence:CCGGCCTTTGGTAATCAAGTACAAACTCGAGTTTGTACTTGATTACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks