EMAIL THIS PAGE TO A FRIEND

WDR89

WD repeat domain 89

Synonyms: C14orf150
UniProtKB ID: Q96FK6
Gene ID:
Mouse(72338) WD repeat domain 89
Rat(314243) WD repeat domain 89
Zebrafish(100148281) WD repeat domain 89
chicken(423510) WD repeat domain 89
dog(100684919) WD repeat domain 89
domestic cat(101085551) WD repeat domain 89
naked mole-rat(101710986) WD repeat domain 89
domestic guinea pig(100729374) WD repeat domain 89
cow(539045) WD repeat domain 89
sheep(101108053) WD repeat domain 89
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000021 MISSION® esiRNA esiRNA targeting human WDR89 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008726 Rosetta Predictions human pricing
NM_080666 Rosetta Predictions human pricing
NM_001014078 Rosetta Predictions rat pricing
XM_001001795 Rosetta Predictions mouse pricing
XM_001476702 Rosetta Predictions mouse pricing
XM_001476717 Rosetta Predictions mouse pricing
XM_001479426 Rosetta Predictions mouse pricing
XM_984248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087648 predicted 507
2 SASI_Hs02_00305544 predicted 1133
3 SASI_Hs01_00087649 predicted 1026
4 SASI_Hs02_00305545 predicted 1059
5 SASI_Hs01_00087651 predicted 865
6 SASI_Hs01_00087652 predicted 805
7 SASI_Hs01_00087653 predicted 527
8 SASI_Hs01_00087654 predicted 1158
9 SASI_Hs01_00087655 predicted 1477
10 SASI_Hs01_00087656 predicted 1421
11 SASI_Hs01_00087650 predicted 444
12 SASI_Hs01_00087657 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031479 predicted 467
2 SASI_Hs02_00362427 predicted 1099
3 SASI_Hs01_00031480 predicted 983
4 SASI_Hs02_00362428 predicted 1020
5 SASI_Hs01_00031482 predicted 831
6 SASI_Hs01_00031483 predicted 774
7 SASI_Hs01_00031484 predicted 485
8 SASI_Hs01_00031485 predicted 1118
9 SASI_Hs01_00031486 predicted 1437
10 SASI_Hs01_00031487 predicted 1377
11 SASI_Hs01_00031481 predicted 403
12 SASI_Hs01_00031488 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085295 predicted 565
2 SASI_Rn01_00085296 predicted 1244
3 SASI_Rn01_00085299 predicted 317
4 SASI_Rn01_00085300 predicted 240
5 SASI_Rn02_00201495 predicted 754
6 SASI_Rn01_00085301 predicted 982
7 SASI_Rn02_00201496 predicted 758
8 SASI_Rn01_00085302 predicted 330
9 SASI_Rn01_00085303 predicted 350
10 SASI_Rn01_00085304 predicted 992
11 SASI_Rn01_00085297 predicted 828
12 SASI_Rn01_00085298 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355269 predicted 308
2 SASI_Mm02_00355270 predicted 367
3 SASI_Mm02_00355271 predicted 317
4 SASI_Mm02_00355272 predicted 878
5 SASI_Mm02_00355273 predicted 1346
6 SASI_Mm02_00355274 predicted 474
7 SASI_Mm02_00355275 predicted 859
8 SASI_Mm02_00355276 predicted 467
9 SASI_Mm02_00355277 predicted 802
10 SASI_Mm02_00355278 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00390794 predicted 871
2 SASI_Mm02_00390795 predicted 1354
3 SASI_Mm02_00390796 predicted 467
4 SASI_Mm02_00390797 predicted 858
5 SASI_Mm02_00390798 predicted 1539
6 SASI_Mm02_00390799 predicted 947
7 SASI_Mm02_00390800 predicted 1068
8 SASI_Mm02_00390801 predicted 1024
9 SASI_Mm02_00390802 predicted 1274
10 SASI_Mm02_00390803 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00390891 predicted 677
2 SASI_Mm02_00390892 predicted 1151
3 SASI_Mm02_00390893 predicted 272
4 SASI_Mm02_00390894 predicted 654
5 SASI_Mm02_00390895 predicted 1331
6 SASI_Mm02_00390896 predicted 751
7 SASI_Mm02_00390897 predicted 865
8 SASI_Mm02_00390898 predicted 823
9 SASI_Mm02_00390899 predicted 241
10 SASI_Mm02_00390900 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00409850 predicted 672
2 SASI_Mm02_00409851 predicted 1151
3 SASI_Mm02_00409852 predicted 267
4 SASI_Mm02_00409853 predicted 658
5 SASI_Mm02_00409854 predicted 1330
6 SASI_Mm02_00409855 predicted 750
7 SASI_Mm02_00409856 predicted 858
8 SASI_Mm02_00409857 predicted 824
9 SASI_Mm02_00409858 predicted 245
10 SASI_Mm02_00409859 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266896 predicted 104
2 SASI_Mm01_00266897 predicted 156
3 SASI_Mm01_00266898 predicted 114
4 SASI_Mm01_00266899 predicted 677
5 SASI_Mm01_00266900 predicted 1146
6 SASI_Mm01_00266901 predicted 661
7 SASI_Mm01_00266902 predicted 259
8 SASI_Mm01_00266903 predicted 589
9 SASI_Mm01_00266904 predicted 187
10 SASI_Mm01_00266905 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080666
WDR89 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 89
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080666.1-1263s1c1
Sequence:CCGGCGAGTACGAGTTCATAGTAATCTCGAGATTACTATGAACTCGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-877s21c1
Sequence:CCGGTGGTCTGGGAAAGGTTATAAACTCGAGTTTATAACCTTTCCCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-394s21c1
Sequence:CCGGCTACGAGAATTTAGTGGATATCTCGAGATATCCACTAAATTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-1018s21c1
Sequence:CCGGGAAGATGCTTTGGACTATTTGCTCGAGCAAATAGTCCAAAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-1321s21c1
Sequence:CCGGCGAGTACGAGTTCATAGTAATCTCGAGATTACTATGAACTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080666.2-2412s21c1
Sequence:CCGGGCGGACTACATAAGCGTTAAACTCGAGTTTAACGCTTATGTAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080666
WDR89 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 89
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080666.1-1263s1c1
Sequence:CCGGCGAGTACGAGTTCATAGTAATCTCGAGATTACTATGAACTCGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-877s21c1
Sequence:CCGGTGGTCTGGGAAAGGTTATAAACTCGAGTTTATAACCTTTCCCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-394s21c1
Sequence:CCGGCTACGAGAATTTAGTGGATATCTCGAGATATCCACTAAATTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-1018s21c1
Sequence:CCGGGAAGATGCTTTGGACTATTTGCTCGAGCAAATAGTCCAAAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-1321s21c1
Sequence:CCGGCGAGTACGAGTTCATAGTAATCTCGAGATTACTATGAACTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080666.2-2412s21c1
Sequence:CCGGGCGGACTACATAAGCGTTAAACTCGAGTTTAACGCTTATGTAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080666
WDR89 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 89
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080666.1-1263s1c1
Sequence:CCGGCGAGTACGAGTTCATAGTAATCTCGAGATTACTATGAACTCGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-877s21c1
Sequence:CCGGTGGTCTGGGAAAGGTTATAAACTCGAGTTTATAACCTTTCCCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-394s21c1
Sequence:CCGGCTACGAGAATTTAGTGGATATCTCGAGATATCCACTAAATTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-1018s21c1
Sequence:CCGGGAAGATGCTTTGGACTATTTGCTCGAGCAAATAGTCCAAAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080666.2-1321s21c1
Sequence:CCGGCGAGTACGAGTTCATAGTAATCTCGAGATTACTATGAACTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080666.2-2412s21c1
Sequence:CCGGGCGGACTACATAAGCGTTAAACTCGAGTTTAACGCTTATGTAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028203
VALIDATED
WDR89 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 89
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-1498s21c1
Sequence:CCGGCCCATCAGTGGAGTTAGTAAACTCGAGTTTACTAACTCCACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-511s21c1
Sequence:CCGGGAGGATGCATTGTTGGTATTTCTCGAGAAATACCAACAATGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-847s21c1
Sequence:CCGGGATGAACCGATCACGTGTTTGCTCGAGCAAACACGTGATCGGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028203.1-591s21c1
Sequence:CCGGAGAGACGCACAGTGATGATATCTCGAGATATCATCACTGTGCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-175s21c1
Sequence:CCGGCTTGGCATAGACACGTCAAAGCTCGAGCTTTGACGTGTCTATGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028203
VALIDATED
WDR89 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 89
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-1498s21c1
Sequence:CCGGCCCATCAGTGGAGTTAGTAAACTCGAGTTTACTAACTCCACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-511s21c1
Sequence:CCGGGAGGATGCATTGTTGGTATTTCTCGAGAAATACCAACAATGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-847s21c1
Sequence:CCGGGATGAACCGATCACGTGTTTGCTCGAGCAAACACGTGATCGGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028203.1-591s21c1
Sequence:CCGGAGAGACGCACAGTGATGATATCTCGAGATATCATCACTGTGCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-175s21c1
Sequence:CCGGCTTGGCATAGACACGTCAAAGCTCGAGCTTTGACGTGTCTATGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028203
VALIDATED
WDR89 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 89
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-1498s21c1
Sequence:CCGGCCCATCAGTGGAGTTAGTAAACTCGAGTTTACTAACTCCACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-511s21c1
Sequence:CCGGGAGGATGCATTGTTGGTATTTCTCGAGAAATACCAACAATGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-847s21c1
Sequence:CCGGGATGAACCGATCACGTGTTTGCTCGAGCAAACACGTGATCGGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028203.1-591s21c1
Sequence:CCGGAGAGACGCACAGTGATGATATCTCGAGATATCATCACTGTGCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028203.1-175s21c1
Sequence:CCGGCTTGGCATAGACACGTCAAAGCTCGAGCTTTGACGTGTCTATGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks