EMAIL THIS PAGE TO A FRIEND

WDR90

WD repeat domain 90

Synonyms: C16orf15 C16orf16 C16orf17 C16orf18 C16orf19
Gene ID:
Mouse(106618) WD repeat domain 90
Rat(287157) WD repeat domain 90
cow(101902709) WD repeat domain 90
sheep(101103368) WD repeat domain 90
domestic guinea pig(100720749) WD repeat domain 90
naked mole-rat(101724807) WD repeat domain 90
Zebrafish(100038787) WD repeat domain 90
Horse(100066920) WD repeat domain 90
domestic cat(101093572) WD repeat domain 90
dog(479894) WD repeat domain 90
chicken(416407) WD repeat domain 90
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145294 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153239 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145294 Rosetta Predictions human pricing
XM_001062276 Rosetta Predictions rat pricing
XM_213271 Rosetta Predictions rat pricing
XM_001478000 Rosetta Predictions mouse pricing
XM_001478010 Rosetta Predictions mouse pricing
XM_001479840 Rosetta Predictions mouse pricing
XM_001479848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365181 predicted 5022
2 SASI_Hs02_00365182 predicted 5010
3 SASI_Hs01_00190208 predicted 1344
4 SASI_Hs01_00190209 predicted 2250
5 SASI_Hs01_00190210 predicted 371
6 SASI_Hs01_00190211 predicted 5062
7 SASI_Hs01_00190212 predicted 2658
8 SASI_Hs01_00190213 predicted 5182
9 SASI_Hs01_00190214 predicted 4196
10 SASI_Hs01_00190215 predicted 4090
11 SASI_Hs01_00190207 predicted 263
12 SASI_Hs01_00190216 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302916 predicted 2957
2 SASI_Rn02_00302917 predicted 4107
3 SASI_Rn02_00302918 predicted 3796
4 SASI_Rn02_00302919 predicted 5607
5 SASI_Rn02_00302920 predicted 1334
6 SASI_Rn02_00302921 predicted 2406
7 SASI_Rn02_00302922 predicted 740
8 SASI_Rn02_00302923 predicted 1198
9 SASI_Rn02_00302924 predicted 5356
10 SASI_Rn02_00302925 predicted 3667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374489 predicted 2958
2 SASI_Rn02_00374490 predicted 4109
3 SASI_Rn02_00374491 predicted 3793
4 SASI_Rn02_00374492 predicted 5607
5 SASI_Rn02_00374493 predicted 1336
6 SASI_Rn02_00374494 predicted 2407
7 SASI_Rn02_00374495 predicted 731
8 SASI_Rn02_00374496 predicted 1195
9 SASI_Rn02_00374497 predicted 5360
10 SASI_Rn02_00374498 predicted 3665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399622 predicted 4514
2 SASI_Mm02_00399623 predicted 3217
3 SASI_Mm02_00399624 predicted 5395
4 SASI_Mm02_00399625 predicted 5302
5 SASI_Mm02_00399626 predicted 3407
6 SASI_Mm02_00399627 predicted 2161
7 SASI_Mm02_00399628 predicted 3950
8 SASI_Mm02_00399629 predicted 3117
9 SASI_Mm02_00399630 predicted 2986
10 SASI_Mm02_00399631 predicted 4650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399692 predicted 4277
2 SASI_Mm02_00399693 predicted 3163
3 SASI_Mm02_00399694 predicted 5148
4 SASI_Mm02_00399695 predicted 5050
5 SASI_Mm02_00399696 predicted 3357
6 SASI_Mm02_00399697 predicted 2109
7 SASI_Mm02_00399698 predicted 3706
8 SASI_Mm02_00399699 predicted 3067
9 SASI_Mm02_00399700 predicted 2935
10 SASI_Mm02_00399701 predicted 4397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00413046 predicted 4521
2 SASI_Mm02_00413047 predicted 5389
3 SASI_Mm02_00413048 predicted 5789
4 SASI_Mm02_00413049 predicted 5298
5 SASI_Mm02_00413050 predicted 4265
6 SASI_Mm02_00413051 predicted 4512
7 SASI_Mm02_00413052 predicted 4253
8 SASI_Mm02_00413053 predicted 5520
9 SASI_Mm02_00413054 predicted 3954
10 SASI_Mm02_00413055 predicted 4988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00413126 predicted 3865
2 SASI_Mm02_00413127 predicted 5140
3 SASI_Mm02_00413128 predicted 5541
4 SASI_Mm02_00413129 predicted 5055
5 SASI_Mm02_00413130 predicted 4017
6 SASI_Mm02_00413131 predicted 4006
7 SASI_Mm02_00413132 predicted 3706
8 SASI_Mm02_00413133 predicted 3933
9 SASI_Mm02_00413134 predicted 4848
10 SASI_Mm02_00413135 predicted 4936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145294
WDR90 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 90
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-5211s21c1
Sequence:CCGGAGTGCACCTGTGCAGGTTTACCTCGAGGTAAACCTGCACAGGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-1306s21c1
Sequence:CCGGGATGGCAGCAGCTCACTATTGCTCGAGCAATAGTGAGCTGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-254s21c1
Sequence:CCGGTGACGGGACGATACCTGTATGCTCGAGCATACAGGTATCGTCCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-648s21c1
Sequence:CCGGGACTCCTATGCCTCGGGAAATCTCGAGATTTCCCGAGGCATAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122726    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145294.3-1777s1c1
Sequence:CCGGCCAGGTTGTCAATGGCCTCATCTCGAGATGAGGCCATTGACAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145294.3-1249s1c1
Sequence:CCGGGCCTGCCACCACGGAGGTAAACTCGAGTTTACCTCCGTGGTGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145294
WDR90 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 90
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-5211s21c1
Sequence:CCGGAGTGCACCTGTGCAGGTTTACCTCGAGGTAAACCTGCACAGGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-1306s21c1
Sequence:CCGGGATGGCAGCAGCTCACTATTGCTCGAGCAATAGTGAGCTGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-254s21c1
Sequence:CCGGTGACGGGACGATACCTGTATGCTCGAGCATACAGGTATCGTCCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-648s21c1
Sequence:CCGGGACTCCTATGCCTCGGGAAATCTCGAGATTTCCCGAGGCATAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122726    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145294.3-1777s1c1
Sequence:CCGGCCAGGTTGTCAATGGCCTCATCTCGAGATGAGGCCATTGACAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145294.3-1249s1c1
Sequence:CCGGGCCTGCCACCACGGAGGTAAACTCGAGTTTACCTCCGTGGTGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145294
WDR90 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 90
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-5211s21c1
Sequence:CCGGAGTGCACCTGTGCAGGTTTACCTCGAGGTAAACCTGCACAGGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-1306s21c1
Sequence:CCGGGATGGCAGCAGCTCACTATTGCTCGAGCAATAGTGAGCTGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-254s21c1
Sequence:CCGGTGACGGGACGATACCTGTATGCTCGAGCATACAGGTATCGTCCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145294.4-648s21c1
Sequence:CCGGGACTCCTATGCCTCGGGAAATCTCGAGATTTCCCGAGGCATAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122726    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145294.3-1777s1c1
Sequence:CCGGCCAGGTTGTCAATGGCCTCATCTCGAGATGAGGCCATTGACAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145294.3-1249s1c1
Sequence:CCGGGCCTGCCACCACGGAGGTAAACTCGAGTTTACCTCCGTGGTGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163766
VALIDATED
WDR90 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 90
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-2669s21c1
Sequence:CCGGATCACCCTTGACGGCAGATTCCTCGAGGAATCTGCCGTCAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-3730s21c1
Sequence:CCGGGCACTTCACACCTCGATATAACTCGAGTTATATCGAGGTGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-4032s21c1
Sequence:CCGGCCCGTTGCCAGATCCGAATTTCTCGAGAAATTCGGATCTGGCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163766.1-1796s21c1
Sequence:CCGGGTGCACACTGACTTCGATATTCTCGAGAATATCGAAGTCAGTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-5764s21c1
Sequence:CCGGCAGACTGTGGATTGCTGTATGCTCGAGCATACAGCAATCCACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163766
VALIDATED
WDR90 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 90
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-2669s21c1
Sequence:CCGGATCACCCTTGACGGCAGATTCCTCGAGGAATCTGCCGTCAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-3730s21c1
Sequence:CCGGGCACTTCACACCTCGATATAACTCGAGTTATATCGAGGTGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-4032s21c1
Sequence:CCGGCCCGTTGCCAGATCCGAATTTCTCGAGAAATTCGGATCTGGCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163766.1-1796s21c1
Sequence:CCGGGTGCACACTGACTTCGATATTCTCGAGAATATCGAAGTCAGTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-5764s21c1
Sequence:CCGGCAGACTGTGGATTGCTGTATGCTCGAGCATACAGCAATCCACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163766
VALIDATED
WDR90 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 90
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-2669s21c1
Sequence:CCGGATCACCCTTGACGGCAGATTCCTCGAGGAATCTGCCGTCAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-3730s21c1
Sequence:CCGGGCACTTCACACCTCGATATAACTCGAGTTATATCGAGGTGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-4032s21c1
Sequence:CCGGCCCGTTGCCAGATCCGAATTTCTCGAGAAATTCGGATCTGGCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163766.1-1796s21c1
Sequence:CCGGGTGCACACTGACTTCGATATTCTCGAGAATATCGAAGTCAGTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001163766.1-5764s21c1
Sequence:CCGGCAGACTGTGGATTGCTGTATGCTCGAGCATACAGCAATCCACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153239
WDR90 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 90
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000016679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153239.2-1094s1c1
Sequence:CCGGCGCTACATCCACGTCCGGTTTCTCGAGAAACCGGACGTGGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153239.2-1519s1c1
Sequence:CCGGCCTGAGGCTCAAGGGCGTCATCTCGAGATGACGCCCTTGAGCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153239
WDR90 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 90
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000016679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153239.2-1094s1c1
Sequence:CCGGCGCTACATCCACGTCCGGTTTCTCGAGAAACCGGACGTGGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153239.2-1519s1c1
Sequence:CCGGCCTGAGGCTCAAGGGCGTCATCTCGAGATGACGCCCTTGAGCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153239
WDR90 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 90
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000016679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153239.2-1094s1c1
Sequence:CCGGCGCTACATCCACGTCCGGTTTCTCGAGAAACCGGACGTGGATGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153239.2-1519s1c1
Sequence:CCGGCCTGAGGCTCAAGGGCGTCATCTCGAGATGACGCCCTTGAGCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks