EMAIL THIS PAGE TO A FRIEND

WDR91

WD repeat domain 91

Gene ID:
Mouse(101240) WD repeat domain 91
Rat(312225) WD repeat domain 91
Zebrafish(402898) WD repeat domain 91
chicken(417939) WD repeat domain 91
dog(482705) WD repeat domain 91
domestic cat(101098617) WD repeat domain 91
naked mole-rat(101710216) WD repeat domain 91
Domestic Rabbit(100343558) WD repeat domain 91
domestic guinea pig(100722012) WD repeat domain 91
cow(540606) WD repeat domain 91
sheep(101122350) WD repeat domain 91
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014149 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014149 Rosetta Predictions human pricing
NM_001127298 Rosetta Predictions rat pricing
NM_001013366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018956 predicted 2239
2 SASI_Hs01_00018957 predicted 2313
3 SASI_Hs01_00018958 predicted 1455
4 SASI_Hs01_00018959 predicted 1845
5 SASI_Hs01_00018960 predicted 1847
6 SASI_Hs01_00018961 predicted 1993
7 SASI_Hs01_00018962 predicted 1540
8 SASI_Hs01_00018963 predicted 1701
9 SASI_Hs01_00018964 predicted 308
10 SASI_Hs01_00018955 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253543 predicted 1784
2 SASI_Rn02_00253544 predicted 1908
3 SASI_Rn02_00253545 predicted 1474
4 SASI_Rn02_00253546 predicted 1724
5 SASI_Rn02_00253547 predicted 1942
6 SASI_Rn02_00253548 predicted 2274
7 SASI_Rn02_00253549 predicted 1741
8 SASI_Rn02_00253550 predicted 1874
9 SASI_Rn02_00253551 predicted 1865
10 SASI_Rn02_00253552 predicted 1612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101386 predicted 1844
2 SASI_Mm01_00101387 predicted 2093
3 SASI_Mm01_00101388 predicted 1889
4 SASI_Mm01_00101389 predicted 521
5 SASI_Mm01_00101390 predicted 451
6 SASI_Mm01_00101391 predicted 1716
7 SASI_Mm01_00101392 predicted 247
8 SASI_Mm01_00101393 predicted 1705
9 SASI_Mm01_00101394 predicted 1591
10 SASI_Mm01_00101395 predicted 2032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014149
WDR91 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 91
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-687s1c1
Sequence:CCGGCAACACAAATTGCCTCCTTATCTCGAGATAAGGAGGCAATTTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1462s1c1
Sequence:CCGGCCAAGAAGAATCTCTGTGAAACTCGAGTTTCACAGAGATTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014149.2-2559s1c1
Sequence:CCGGCCAGTAGAAATTGACAGTATTCTCGAGAATACTGTCAATTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014149.2-2312s1c1
Sequence:CCGGGAGGAGATATAGGACAGGAAACTCGAGTTTCCTGTCCTATATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-1856s1c1
Sequence:CCGGCTATGATGAGAACACCGTGTACTCGAGTACACGGTGTTCTCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-2044s1c1
Sequence:CCGGCGGAGGGAAATTACATGCTGACTCGAGTCAGCATGTAATTTCCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-564s1c1
Sequence:CCGGCAGAGGACTAACCAGGTTCAACTCGAGTTGAACCTGGTTAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1490s1c1
Sequence:CCGGCAACGACAACATGCCCAGAATCTCGAGATTCTGGGCATGTTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1452s1c1
Sequence:CCGGGACACGGAAGCCAAGAAGAATCTCGAGATTCTTCTTGGCTTCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-698s1c1
Sequence:CCGGGCCTCCTTATGTCTCCAACATCTCGAGATGTTGGAGACATAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014149
WDR91 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 91
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-687s1c1
Sequence:CCGGCAACACAAATTGCCTCCTTATCTCGAGATAAGGAGGCAATTTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1462s1c1
Sequence:CCGGCCAAGAAGAATCTCTGTGAAACTCGAGTTTCACAGAGATTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014149.2-2559s1c1
Sequence:CCGGCCAGTAGAAATTGACAGTATTCTCGAGAATACTGTCAATTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014149.2-2312s1c1
Sequence:CCGGGAGGAGATATAGGACAGGAAACTCGAGTTTCCTGTCCTATATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-1856s1c1
Sequence:CCGGCTATGATGAGAACACCGTGTACTCGAGTACACGGTGTTCTCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-2044s1c1
Sequence:CCGGCGGAGGGAAATTACATGCTGACTCGAGTCAGCATGTAATTTCCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-564s1c1
Sequence:CCGGCAGAGGACTAACCAGGTTCAACTCGAGTTGAACCTGGTTAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1490s1c1
Sequence:CCGGCAACGACAACATGCCCAGAATCTCGAGATTCTGGGCATGTTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1452s1c1
Sequence:CCGGGACACGGAAGCCAAGAAGAATCTCGAGATTCTTCTTGGCTTCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-698s1c1
Sequence:CCGGGCCTCCTTATGTCTCCAACATCTCGAGATGTTGGAGACATAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014149
WDR91 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 91
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-687s1c1
Sequence:CCGGCAACACAAATTGCCTCCTTATCTCGAGATAAGGAGGCAATTTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1462s1c1
Sequence:CCGGCCAAGAAGAATCTCTGTGAAACTCGAGTTTCACAGAGATTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014149.2-2559s1c1
Sequence:CCGGCCAGTAGAAATTGACAGTATTCTCGAGAATACTGTCAATTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014149.2-2312s1c1
Sequence:CCGGGAGGAGATATAGGACAGGAAACTCGAGTTTCCTGTCCTATATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-1856s1c1
Sequence:CCGGCTATGATGAGAACACCGTGTACTCGAGTACACGGTGTTCTCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-2044s1c1
Sequence:CCGGCGGAGGGAAATTACATGCTGACTCGAGTCAGCATGTAATTTCCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-564s1c1
Sequence:CCGGCAGAGGACTAACCAGGTTCAACTCGAGTTGAACCTGGTTAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1490s1c1
Sequence:CCGGCAACGACAACATGCCCAGAATCTCGAGATTCTGGGCATGTTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014149.2-1452s1c1
Sequence:CCGGGACACGGAAGCCAAGAAGAATCTCGAGATTCTTCTTGGCTTCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014149.2-698s1c1
Sequence:CCGGGCCTCCTTATGTCTCCAACATCTCGAGATGTTGGAGACATAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013366
VALIDATED
WDR91 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 91
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013366.1-312s1c1
Sequence:CCGGCCAGACAAACCGAAATGACAACTCGAGTTGTCATTTCGGTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-868s1c1
Sequence:CCGGGCTCAGAGTTCAGCCAAGAAACTCGAGTTTCTTGGCTGAACTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-2453s1c1
Sequence:CCGGGAGACTAGAACCGTGGCTATACTCGAGTATAGCCACGGTTCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-2546s1c1
Sequence:CCGGCAAGAGGCATTGACTGTATTTCTCGAGAAATACAGTCAATGCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013366.1-2492s1c1
Sequence:CCGGCACAGGACTGATGCTAAGGAACTCGAGTTCCTTAGCATCAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-159s1c1
Sequence:CCGGGCAACAGTTGATGCAGGTTTACTCGAGTAAACCTGCATCAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-1892s1c1
Sequence:CCGGGCAAGTTCATCCAGTGGAATACTCGAGTATTCCACTGGATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-622s1c1
Sequence:CCGGGCTGAAATCCATCGACTAAAGCTCGAGCTTTAGTCGATGGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013366
VALIDATED
WDR91 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 91
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013366.1-312s1c1
Sequence:CCGGCCAGACAAACCGAAATGACAACTCGAGTTGTCATTTCGGTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-868s1c1
Sequence:CCGGGCTCAGAGTTCAGCCAAGAAACTCGAGTTTCTTGGCTGAACTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-2453s1c1
Sequence:CCGGGAGACTAGAACCGTGGCTATACTCGAGTATAGCCACGGTTCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-2546s1c1
Sequence:CCGGCAAGAGGCATTGACTGTATTTCTCGAGAAATACAGTCAATGCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013366.1-2492s1c1
Sequence:CCGGCACAGGACTGATGCTAAGGAACTCGAGTTCCTTAGCATCAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-159s1c1
Sequence:CCGGGCAACAGTTGATGCAGGTTTACTCGAGTAAACCTGCATCAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-1892s1c1
Sequence:CCGGGCAAGTTCATCCAGTGGAATACTCGAGTATTCCACTGGATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-622s1c1
Sequence:CCGGGCTGAAATCCATCGACTAAAGCTCGAGCTTTAGTCGATGGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013366
VALIDATED
WDR91 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 91
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013366.1-312s1c1
Sequence:CCGGCCAGACAAACCGAAATGACAACTCGAGTTGTCATTTCGGTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-868s1c1
Sequence:CCGGGCTCAGAGTTCAGCCAAGAAACTCGAGTTTCTTGGCTGAACTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-2453s1c1
Sequence:CCGGGAGACTAGAACCGTGGCTATACTCGAGTATAGCCACGGTTCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013366.1-2546s1c1
Sequence:CCGGCAAGAGGCATTGACTGTATTTCTCGAGAAATACAGTCAATGCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013366.1-2492s1c1
Sequence:CCGGCACAGGACTGATGCTAAGGAACTCGAGTTCCTTAGCATCAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-159s1c1
Sequence:CCGGGCAACAGTTGATGCAGGTTTACTCGAGTAAACCTGCATCAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-1892s1c1
Sequence:CCGGGCAAGTTCATCCAGTGGAATACTCGAGTATTCCACTGGATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013366.1-622s1c1
Sequence:CCGGGCTGAAATCCATCGACTAAAGCTCGAGCTTTAGTCGATGGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks