EMAIL THIS PAGE TO A FRIEND

WDR92

WD repeat domain 92

UniProtKB ID: Q96MX6, Q96CR6
Gene ID:
Human(116143) Summary: This gene encodes a protein with two WD40 repeat domains thought to be involved in an apoptosis via activation of caspase-3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(103784) WD repeat domain 92
Rat(498418) WD repeat domain 92
cow(540032) WD repeat domain 92
sheep(101111267) WD repeat domain 92
domestic guinea pig(100730725) WD repeat domain 92
naked mole-rat(101707214) WD repeat domain 92
Zebrafish(550284) WD repeat domain 92
Horse(100051109) WD repeat domain 92
domestic cat(101089686) WD repeat domain 92
dog(481401) WD repeat domain 92
chicken(769534) WD repeat domain 92
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138458 Rosetta Predictions human pricing
NM_001127559 Rosetta Predictions rat pricing
XM_573667 Rosetta Predictions rat pricing
NM_178909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245163 predicted 576
2 SASI_Hs01_00245164 predicted 210
3 SASI_Hs01_00245165 predicted 953
4 SASI_Hs01_00245166 predicted 343
5 SASI_Hs01_00245167 predicted 743
6 SASI_Hs02_00363631 predicted 682
7 SASI_Hs02_00363632 predicted 736
8 SASI_Hs02_00363633 predicted 673
9 SASI_Hs02_00363634 predicted 949
10 SASI_Hs01_00245171 predicted 390
11 SASI_Hs01_00245162 predicted 684
12 SASI_Hs01_00245168 predicted 597
13 SASI_Hs01_00245169 predicted 403
14 SASI_Hs01_00245170 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254343 predicted 615
2 SASI_Rn02_00254344 predicted 393
3 SASI_Rn02_00254345 predicted 700
4 SASI_Rn02_00254346 predicted 1189
5 SASI_Rn02_00254347 predicted 587
6 SASI_Rn02_00254348 predicted 840
7 SASI_Rn02_00254349 predicted 741
8 SASI_Rn02_00254350 predicted 385
9 SASI_Rn02_00254351 predicted 1125
10 SASI_Rn02_00254352 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177947 predicted 225
2 SASI_Rn01_00177948 predicted 309
3 SASI_Rn01_00177949 predicted 364
4 SASI_Rn01_00177950 predicted 236
5 SASI_Rn01_00177951 predicted 273
6 SASI_Rn01_00177952 predicted 213
7 SASI_Rn01_00177953 predicted 312
8 SASI_Rn01_00177954 predicted 303
9 SASI_Rn01_00177955 predicted 210
10 SASI_Rn01_00177956 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349510 predicted 332
2 SASI_Mm02_00349511 predicted 942
3 SASI_Mm02_00349512 predicted 201
4 SASI_Mm02_00349513 predicted 416
5 SASI_Mm02_00349514 predicted 1188
6 SASI_Mm02_00349515 predicted 1126
7 SASI_Mm02_00349516 predicted 1218
8 SASI_Mm02_00349517 predicted 533
9 SASI_Mm02_00349518 predicted 754
10 SASI_Mm02_00349519 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138458
VALIDATED
WDR92 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 92
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138458.2-667s21c1
Sequence:CCGGGATCTCAGAAATATGGCATTACTCGAGTAATGCCATATTTCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-114s21c1
Sequence:CCGGCCATATCCAGAAGGGCTTCAACTCGAGTTGAAGCCCTTCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-1503s21c1
Sequence:CCGGAGGAACACTCACACAATTTAACTCGAGTTAAATTGTGTGAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138458.2-1115s21c1
Sequence:CCGGCGGTGAGAGTACTGATCGTTACTCGAGTAACGATCAGTACTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-940s21c1
Sequence:CCGGTGGAAGTATGAATACCCTATTCTCGAGAATAGGGTATTCATACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-275s1c1
Sequence:CCGGCCAAACCTATTAAATGTGGAACTCGAGTTCCACATTTAATAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-1115s1c1
Sequence:CCGGCGGTGAGAGTACTGATCGTTACTCGAGTAACGATCAGTACTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-376s1c1
Sequence:CCGGGCTCCAGAGATGCCAGTATATCTCGAGATATACTGGCATCTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-940s1c1
Sequence:CCGGTGGAAGTATGAATACCCTATTCTCGAGAATAGGGTATTCATACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138458.1-114s1c1
Sequence:CCGGCCATATCCAGAAGGGCTTCAACTCGAGTTGAAGCCCTTCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138458
VALIDATED
WDR92 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 92
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138458.2-667s21c1
Sequence:CCGGGATCTCAGAAATATGGCATTACTCGAGTAATGCCATATTTCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-114s21c1
Sequence:CCGGCCATATCCAGAAGGGCTTCAACTCGAGTTGAAGCCCTTCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-1503s21c1
Sequence:CCGGAGGAACACTCACACAATTTAACTCGAGTTAAATTGTGTGAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138458.2-1115s21c1
Sequence:CCGGCGGTGAGAGTACTGATCGTTACTCGAGTAACGATCAGTACTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-940s21c1
Sequence:CCGGTGGAAGTATGAATACCCTATTCTCGAGAATAGGGTATTCATACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-275s1c1
Sequence:CCGGCCAAACCTATTAAATGTGGAACTCGAGTTCCACATTTAATAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-1115s1c1
Sequence:CCGGCGGTGAGAGTACTGATCGTTACTCGAGTAACGATCAGTACTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-376s1c1
Sequence:CCGGGCTCCAGAGATGCCAGTATATCTCGAGATATACTGGCATCTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-940s1c1
Sequence:CCGGTGGAAGTATGAATACCCTATTCTCGAGAATAGGGTATTCATACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138458.1-114s1c1
Sequence:CCGGCCATATCCAGAAGGGCTTCAACTCGAGTTGAAGCCCTTCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138458
VALIDATED
WDR92 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 92
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138458.2-667s21c1
Sequence:CCGGGATCTCAGAAATATGGCATTACTCGAGTAATGCCATATTTCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-114s21c1
Sequence:CCGGCCATATCCAGAAGGGCTTCAACTCGAGTTGAAGCCCTTCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-1503s21c1
Sequence:CCGGAGGAACACTCACACAATTTAACTCGAGTTAAATTGTGTGAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138458.2-1115s21c1
Sequence:CCGGCGGTGAGAGTACTGATCGTTACTCGAGTAACGATCAGTACTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_138458.2-940s21c1
Sequence:CCGGTGGAAGTATGAATACCCTATTCTCGAGAATAGGGTATTCATACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-275s1c1
Sequence:CCGGCCAAACCTATTAAATGTGGAACTCGAGTTCCACATTTAATAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-1115s1c1
Sequence:CCGGCGGTGAGAGTACTGATCGTTACTCGAGTAACGATCAGTACTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-376s1c1
Sequence:CCGGGCTCCAGAGATGCCAGTATATCTCGAGATATACTGGCATCTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138458.1-940s1c1
Sequence:CCGGTGGAAGTATGAATACCCTATTCTCGAGAATAGGGTATTCATACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138458.1-114s1c1
Sequence:CCGGCCATATCCAGAAGGGCTTCAACTCGAGTTGAAGCCCTTCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178909
VALIDATED
WDR92 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 92
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178909.4-2122s21c1
Sequence:CCGGCTCCGGAAGGACTGGATTAATCTCGAGATTAATCCAGTCCTTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-1077s21c1
Sequence:CCGGCTCTGCGTCTGTAGTTCATTTCTCGAGAAATGAACTACAGACGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-1106s21c1
Sequence:CCGGGGTGCGTGTGCTGATAGTTACCTCGAGGTAACTATCAGCACACGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178909.4-169s21c1
Sequence:CCGGTCGTGACGATGGGCAACTTTGCTCGAGCAAAGTTGCCCATCGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-942s21c1
Sequence:CCGGTACCCAACTCAGCGGTCAAAGCTCGAGCTTTGACCGCTGAGTTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178909
VALIDATED
WDR92 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 92
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178909.4-2122s21c1
Sequence:CCGGCTCCGGAAGGACTGGATTAATCTCGAGATTAATCCAGTCCTTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-1077s21c1
Sequence:CCGGCTCTGCGTCTGTAGTTCATTTCTCGAGAAATGAACTACAGACGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-1106s21c1
Sequence:CCGGGGTGCGTGTGCTGATAGTTACCTCGAGGTAACTATCAGCACACGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178909.4-169s21c1
Sequence:CCGGTCGTGACGATGGGCAACTTTGCTCGAGCAAAGTTGCCCATCGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-942s21c1
Sequence:CCGGTACCCAACTCAGCGGTCAAAGCTCGAGCTTTGACCGCTGAGTTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178909
VALIDATED
WDR92 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 92
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178909.4-2122s21c1
Sequence:CCGGCTCCGGAAGGACTGGATTAATCTCGAGATTAATCCAGTCCTTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-1077s21c1
Sequence:CCGGCTCTGCGTCTGTAGTTCATTTCTCGAGAAATGAACTACAGACGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-1106s21c1
Sequence:CCGGGGTGCGTGTGCTGATAGTTACCTCGAGGTAACTATCAGCACACGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178909.4-169s21c1
Sequence:CCGGTCGTGACGATGGGCAACTTTGCTCGAGCAAAGTTGCCCATCGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178909.4-942s21c1
Sequence:CCGGTACCCAACTCAGCGGTCAAAGCTCGAGCTTTGACCGCTGAGTTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks