EMAIL THIS PAGE TO A FRIEND

WDR93

WD repeat domain 93

UniProtKB ID: Q6P2C0, Q8N7Y8, Q9NP89
Gene ID:
Mouse(626359) WD repeat domain 93
Rat(499189) WD repeat domain 93
dog(488737) WD repeat domain 93
Horse(100053682) WD repeat domain 93
domestic cat(101090110) WD repeat domain 93
naked mole-rat(101705299) WD repeat domain 93
domestic guinea pig(100730289) WD repeat domain 93
cow(515609) WD repeat domain 93
sheep(101104608) WD repeat domain 93
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020212 Rosetta Predictions human pricing
XM_001065533 Rosetta Predictions rat pricing
XM_574479 Rosetta Predictions rat pricing
NM_001037927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135112 predicted 1258
2 SASI_Hs01_00135113 predicted 266
3 SASI_Hs02_00353146 predicted 387
4 SASI_Hs01_00135115 predicted 669
5 SASI_Hs02_00353147 predicted 567
6 SASI_Hs01_00135117 predicted 1266
7 SASI_Hs01_00135120 predicted 742
8 SASI_Hs01_00135121 predicted 410
9 SASI_Hs02_00353148 predicted 969
10 SASI_Hs02_00353149 predicted 1286
11 SASI_Hs01_00135114 predicted 592
12 SASI_Hs01_00135116 predicted 644
13 SASI_Hs01_00135118 predicted 972
14 SASI_Hs01_00135119 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314514 predicted 266
2 SASI_Rn02_00314515 predicted 1137
3 SASI_Rn02_00314516 predicted 1686
4 SASI_Rn02_00314517 predicted 896
5 SASI_Rn02_00314518 predicted 730
6 SASI_Rn02_00314519 predicted 473
7 SASI_Rn02_00314520 predicted 797
8 SASI_Rn02_00314521 predicted 759
9 SASI_Rn02_00314522 predicted 1191
10 SASI_Rn02_00314523 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402081 predicted 266
2 SASI_Rn02_00402082 predicted 1134
3 SASI_Rn02_00402083 predicted 1690
4 SASI_Rn02_00402084 predicted 897
5 SASI_Rn02_00402085 predicted 729
6 SASI_Rn02_00402086 predicted 474
7 SASI_Rn02_00402087 predicted 793
8 SASI_Rn02_00402088 predicted 753
9 SASI_Rn02_00402089 predicted 1192
10 SASI_Rn02_00402090 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104813 predicted 348
2 SASI_Mm01_00104814 predicted 840
3 SASI_Mm01_00104815 predicted 957
4 SASI_Mm01_00104816 predicted 821
5 SASI_Mm01_00104817 predicted 467
6 SASI_Mm01_00104818 predicted 374
7 SASI_Mm01_00104819 predicted 1513
8 SASI_Mm01_00104820 predicted 217
9 SASI_Mm02_00289531 predicted 866
10 SASI_Mm02_00289532 predicted 286
11 SASI_Mm01_00104811 predicted 734
12 SASI_Mm01_00104812 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020212
WDR93 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 93
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-201s1c1
Sequence:CCGGCCTAAAGACGATGAACAGGATCTCGAGATCCTGTTCATCGTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1504s1c1
Sequence:CCGGCGGTCCACAAAGGACAGAATACTCGAGTATTCTGTCCTTTGTGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1172s1c1
Sequence:CCGGCCTTCTTCCTAGCTGCCTATTCTCGAGAATAGGCAGCTAGGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-284s1c1
Sequence:CCGGCAAGCTGGTGAACCTTCTGTTCTCGAGAACAGAAGGTTCACCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-1045s1c1
Sequence:CCGGCCGGGCAGAATCATTTCATCACTCGAGTGATGAAATGATTCTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-2135s1c1
Sequence:CCGGGCTCCAGAGAGAGAACTTCAACTCGAGTTGAAGTTCTCTCTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-1755s1c1
Sequence:CCGGGCCAAGCGTGAAATCATCTGTCTCGAGACAGATGATTTCACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020212.1-2228s1c1
Sequence:CCGGCTGAGGCCAAGAGAAATGTAACTCGAGTTACATTTCTCTTGGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1863s1c1
Sequence:CCGGCGAGGAGACTATTCACATGAACTCGAGTTCATGTGAATAGTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1647s1c1
Sequence:CCGGCCTGTAAAGCACCTGGATAAACTCGAGTTTATCCAGGTGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020212
WDR93 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 93
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-201s1c1
Sequence:CCGGCCTAAAGACGATGAACAGGATCTCGAGATCCTGTTCATCGTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1504s1c1
Sequence:CCGGCGGTCCACAAAGGACAGAATACTCGAGTATTCTGTCCTTTGTGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1172s1c1
Sequence:CCGGCCTTCTTCCTAGCTGCCTATTCTCGAGAATAGGCAGCTAGGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-284s1c1
Sequence:CCGGCAAGCTGGTGAACCTTCTGTTCTCGAGAACAGAAGGTTCACCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-1045s1c1
Sequence:CCGGCCGGGCAGAATCATTTCATCACTCGAGTGATGAAATGATTCTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-2135s1c1
Sequence:CCGGGCTCCAGAGAGAGAACTTCAACTCGAGTTGAAGTTCTCTCTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-1755s1c1
Sequence:CCGGGCCAAGCGTGAAATCATCTGTCTCGAGACAGATGATTTCACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020212.1-2228s1c1
Sequence:CCGGCTGAGGCCAAGAGAAATGTAACTCGAGTTACATTTCTCTTGGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1863s1c1
Sequence:CCGGCGAGGAGACTATTCACATGAACTCGAGTTCATGTGAATAGTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1647s1c1
Sequence:CCGGCCTGTAAAGCACCTGGATAAACTCGAGTTTATCCAGGTGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020212
WDR93 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 93
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-201s1c1
Sequence:CCGGCCTAAAGACGATGAACAGGATCTCGAGATCCTGTTCATCGTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1504s1c1
Sequence:CCGGCGGTCCACAAAGGACAGAATACTCGAGTATTCTGTCCTTTGTGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1172s1c1
Sequence:CCGGCCTTCTTCCTAGCTGCCTATTCTCGAGAATAGGCAGCTAGGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-284s1c1
Sequence:CCGGCAAGCTGGTGAACCTTCTGTTCTCGAGAACAGAAGGTTCACCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-1045s1c1
Sequence:CCGGCCGGGCAGAATCATTTCATCACTCGAGTGATGAAATGATTCTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-2135s1c1
Sequence:CCGGGCTCCAGAGAGAGAACTTCAACTCGAGTTGAAGTTCTCTCTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020212.1-1755s1c1
Sequence:CCGGGCCAAGCGTGAAATCATCTGTCTCGAGACAGATGATTTCACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020212.1-2228s1c1
Sequence:CCGGCTGAGGCCAAGAGAAATGTAACTCGAGTTACATTTCTCTTGGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1863s1c1
Sequence:CCGGCGAGGAGACTATTCACATGAACTCGAGTTCATGTGAATAGTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020212.1-1647s1c1
Sequence:CCGGCCTGTAAAGCACCTGGATAAACTCGAGTTTATCCAGGTGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037927
WDR93 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 93
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-514s21c1
Sequence:CCGGTGGGAAATGACGTACTTATTGCTCGAGCAATAAGTACGTCATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-964s21c1
Sequence:CCGGCCATAGCAGGGACCACATTTACTCGAGTAAATGTGGTCCCTGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-217s21c1
Sequence:CCGGCTCAGCCCTATCGAATGATAACTCGAGTTATCATTCGATAGGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-538s21c1
Sequence:CCGGCTATCGACGAAATGGGTATTGCTCGAGCAATACCCATTTCGTCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-1826s21c1
Sequence:CCGGATCTCCACACCATCCATATTTCTCGAGAAATATGGATGGTGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037927
WDR93 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 93
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-514s21c1
Sequence:CCGGTGGGAAATGACGTACTTATTGCTCGAGCAATAAGTACGTCATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-964s21c1
Sequence:CCGGCCATAGCAGGGACCACATTTACTCGAGTAAATGTGGTCCCTGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-217s21c1
Sequence:CCGGCTCAGCCCTATCGAATGATAACTCGAGTTATCATTCGATAGGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-538s21c1
Sequence:CCGGCTATCGACGAAATGGGTATTGCTCGAGCAATACCCATTTCGTCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-1826s21c1
Sequence:CCGGATCTCCACACCATCCATATTTCTCGAGAAATATGGATGGTGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037927
WDR93 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 93
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-514s21c1
Sequence:CCGGTGGGAAATGACGTACTTATTGCTCGAGCAATAAGTACGTCATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-964s21c1
Sequence:CCGGCCATAGCAGGGACCACATTTACTCGAGTAAATGTGGTCCCTGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-217s21c1
Sequence:CCGGCTCAGCCCTATCGAATGATAACTCGAGTTATCATTCGATAGGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-538s21c1
Sequence:CCGGCTATCGACGAAATGGGTATTGCTCGAGCAATACCCATTTCGTCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037927.1-1826s21c1
Sequence:CCGGATCTCCACACCATCCATATTTCTCGAGAAATATGGATGGTGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks