EMAIL THIS PAGE TO A FRIEND

WDR96

WD repeat domain 96

Synonyms: C10orf79 bA373N18.2
UniProtKB ID: Q8NDM7, Q8N9Z8, Q8NE17, Q9H085, Q9H5W3
Gene ID:
Mouse(100048534) WD repeat domain 96
Rat(365476) WD repeat domain 96
Zebrafish(568701) WD repeat domain 96
chicken(423879) WD repeat domain 96
Horse(100059488) WD repeat domain 96
domestic cat(101089897) WD repeat domain 96
dog(486877) WD repeat domain 96
domestic guinea pig(100720899) WD repeat domain 96
naked mole-rat(101711286) WD repeat domain 96
cow(518801) WD repeat domain 96
sheep(101114833) WD repeat domain 96
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038128 Anti-CFAP43 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025145 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025145 Rosetta Predictions human pricing
XM_001060079 Rosetta Predictions rat pricing
XM_345041 Rosetta Predictions rat pricing
XM_001480785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357873 predicted 1105
2 SASI_Hs01_00202178 predicted 1286
3 SASI_Hs02_00357874 predicted 2337
4 SASI_Hs02_00357875 predicted 841
5 SASI_Hs01_00202179 predicted 4466
6 SASI_Hs01_00202180 predicted 3037
7 SASI_Hs01_00202183 predicted 2895
8 SASI_Hs01_00202185 predicted 668
9 SASI_Hs01_00202186 predicted 1467
10 SASI_Hs02_00357876 predicted 4279
11 SASI_Hs01_00202177 predicted 4616
12 SASI_Hs01_00202181 predicted 1140
13 SASI_Hs01_00202182 predicted 1981
14 SASI_Hs01_00202184 predicted 3887
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295302 predicted 1460
2 SASI_Rn02_00295303 predicted 2588
3 SASI_Rn02_00295304 predicted 3349
4 SASI_Rn02_00295305 predicted 4312
5 SASI_Rn02_00295306 predicted 2954
6 SASI_Rn02_00295307 predicted 576
7 SASI_Rn02_00295308 predicted 984
8 SASI_Rn02_00295309 predicted 3042
9 SASI_Rn02_00295310 predicted 2347
10 SASI_Rn02_00295311 predicted 5032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397891 predicted 1083
2 SASI_Rn02_00397892 predicted 1424
3 SASI_Rn02_00397893 predicted 4644
4 SASI_Rn02_00397894 predicted 702
5 SASI_Rn02_00397895 predicted 537
6 SASI_Rn02_00397896 predicted 442
7 SASI_Rn02_00397897 predicted 949
8 SASI_Rn02_00397898 predicted 4984
9 SASI_Rn02_00397899 predicted 939
10 SASI_Rn02_00397900 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00419782 predicted 1190
2 SASI_Mm02_00419783 predicted 219
3 SASI_Mm02_00419784 predicted 1042
4 SASI_Mm02_00419785 predicted 1274
5 SASI_Mm02_00419786 predicted 1630
6 SASI_Mm02_00419787 predicted 299
7 SASI_Mm02_00419788 predicted 1110
8 SASI_Mm02_00419789 predicted 1315
9 SASI_Mm02_00419790 predicted 1214
10 SASI_Mm02_00419791 predicted 931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025145
WDR96 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 96
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-1799s1c1
Sequence:CCGGGCCACAAGTTTCCACAACCTTCTCGAGAAGGTTGTGGAAACTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-2700s1c1
Sequence:CCGGGCAAAGATGATAAAGGATGTACTCGAGTACATCCTTTATCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-1380s1c1
Sequence:CCGGGCTTGTGTAAGCAAGATTTATCTCGAGATAAATCTTGCTTACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-2102s21c1
Sequence:CCGGGTGTATCCGAGACGTTTATACCTCGAGGTATAAACGTCTCGGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025145.5-5133s21c1
Sequence:CCGGACAAGGCCAAATCAATCATTTCTCGAGAAATGATTGATTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-4731s21c1
Sequence:CCGGTATGAGGCTCTGATTAGTATTCTCGAGAATACTAATCAGAGCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-3053s21c1
Sequence:CCGGTGGTAGTCTGAGTACTGATTTCTCGAGAAATCAGTACTCAGACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-849s21c1
Sequence:CCGGCGGCCGAAAGATGATCTATATCTCGAGATATAGATCATCTTTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025145
WDR96 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 96
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-1799s1c1
Sequence:CCGGGCCACAAGTTTCCACAACCTTCTCGAGAAGGTTGTGGAAACTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-2700s1c1
Sequence:CCGGGCAAAGATGATAAAGGATGTACTCGAGTACATCCTTTATCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-1380s1c1
Sequence:CCGGGCTTGTGTAAGCAAGATTTATCTCGAGATAAATCTTGCTTACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-2102s21c1
Sequence:CCGGGTGTATCCGAGACGTTTATACCTCGAGGTATAAACGTCTCGGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025145.5-5133s21c1
Sequence:CCGGACAAGGCCAAATCAATCATTTCTCGAGAAATGATTGATTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-4731s21c1
Sequence:CCGGTATGAGGCTCTGATTAGTATTCTCGAGAATACTAATCAGAGCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-3053s21c1
Sequence:CCGGTGGTAGTCTGAGTACTGATTTCTCGAGAAATCAGTACTCAGACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-849s21c1
Sequence:CCGGCGGCCGAAAGATGATCTATATCTCGAGATATAGATCATCTTTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025145
WDR96 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 96
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-1799s1c1
Sequence:CCGGGCCACAAGTTTCCACAACCTTCTCGAGAAGGTTGTGGAAACTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-2700s1c1
Sequence:CCGGGCAAAGATGATAAAGGATGTACTCGAGTACATCCTTTATCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025145.3-1380s1c1
Sequence:CCGGGCTTGTGTAAGCAAGATTTATCTCGAGATAAATCTTGCTTACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-2102s21c1
Sequence:CCGGGTGTATCCGAGACGTTTATACCTCGAGGTATAAACGTCTCGGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025145.5-5133s21c1
Sequence:CCGGACAAGGCCAAATCAATCATTTCTCGAGAAATGATTGATTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-4731s21c1
Sequence:CCGGTATGAGGCTCTGATTAGTATTCTCGAGAATACTAATCAGAGCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-3053s21c1
Sequence:CCGGTGGTAGTCTGAGTACTGATTTCTCGAGAAATCAGTACTCAGACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025145.5-849s21c1
Sequence:CCGGCGGCCGAAAGATGATCTATATCTCGAGATATAGATCATCTTTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks