EMAIL THIS PAGE TO A FRIEND

WDSUB1

WD repeat, sterile alpha motif and U-box domain containing 1

Synonyms: UBOX6 WDSAM1
UniProtKB ID: Q8N9V3, Q53TI9, Q8N6N8
Gene ID:
Mouse(72137) WD repeat, SAM and U-box domain containing 1
Rat(362137) WD repeat, sterile alpha motif and U-box domain containing 1
Zebrafish(777721) WD repeat, sterile alpha motif and U-box domain containing 1
chicken(424331) WD repeat, sterile alpha motif and U-box domain containing 1
dog(478761) WD repeat, sterile alpha motif and U-box domain containing 1
Horse(100051049) WD repeat, sterile alpha motif and U-box domain containing 1
domestic cat(101093126) WD repeat, sterile alpha motif and U-box domain containing 1
cow(783784) WD repeat, sterile alpha motif and U-box domain containing 1
sheep(101111522) WD repeat, sterile alpha motif and U-box domain containing 1
naked mole-rat(101705204) WD repeat, sterile alpha motif and U-box domain containing 1
Domestic Rabbit(100359288) WD repeat, sterile alpha motif and U-box domain containing 1
domestic guinea pig(100719372) WD repeat, sterile alpha motif and U-box domain containing 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128212 Rosetta Predictions human pricing
NM_001128213 Rosetta Predictions human pricing
NM_152528 Rosetta Predictions human pricing
NM_001014179 Rosetta Predictions rat pricing
NM_028118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330866 predicted 529
2 SASI_Hs02_00330867 predicted 305
3 SASI_Hs02_00330868 predicted 1501
4 SASI_Hs02_00330869 predicted 394
5 SASI_Hs02_00330870 predicted 1298
6 SASI_Hs02_00330871 predicted 294
7 SASI_Hs02_00330872 predicted 1529
8 SASI_Hs02_00330873 predicted 1068
9 SASI_Hs02_00330874 predicted 1172
10 SASI_Hs02_00330875 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330876 predicted 621
2 SASI_Hs02_00330877 predicted 275
3 SASI_Hs02_00330878 predicted 397
4 SASI_Hs02_00330879 predicted 1586
5 SASI_Hs02_00330880 predicted 491
6 SASI_Hs02_00330881 predicted 1387
7 SASI_Hs02_00330882 predicted 385
8 SASI_Hs02_00330883 predicted 1622
9 SASI_Hs02_00330884 predicted 1166
10 SASI_Hs02_00330885 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012814 predicted 519
2 SASI_Hs01_00012815 predicted 286
3 SASI_Hs02_00366327 predicted 1477
4 SASI_Hs01_00012817 predicted 375
5 SASI_Hs01_00012818 predicted 1273
6 SASI_Hs01_00012819 predicted 282
7 SASI_Hs01_00012820 predicted 1514
8 SASI_Hs01_00012822 predicted 1057
9 SASI_Hs01_00012823 predicted 1151
10 SASI_Hs02_00366328 predicted 404
11 SASI_Hs01_00012816 predicted 259
12 SASI_Hs01_00012821 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105523 predicted 985
2 SASI_Rn01_00105524 predicted 348
3 SASI_Rn01_00105525 predicted 1427
4 SASI_Rn01_00105526 predicted 343
5 SASI_Rn01_00105527 predicted 1301
6 SASI_Rn02_00201681 predicted 978
7 SASI_Rn01_00105529 predicted 1262
8 SASI_Rn01_00105530 predicted 1350
9 SASI_Rn01_00105531 predicted 574
10 SASI_Rn01_00105532 predicted 1234
11 SASI_Rn01_00105528 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034587 predicted 1154
2 SASI_Mm01_00034590 predicted 847
3 SASI_Mm01_00034591 predicted 1425
4 SASI_Mm02_00333374 predicted 1082
5 SASI_Mm01_00034592 predicted 1032
6 SASI_Mm01_00034593 predicted 820
7 SASI_Mm01_00034594 predicted 845
8 SASI_Mm01_00034595 predicted 1233
9 SASI_Mm01_00034596 predicted 1280
10 SASI_Mm02_00333375 predicted 578
11 SASI_Mm01_00034588 predicted 1083
12 SASI_Mm01_00034589 predicted 1175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152528
VALIDATED
WDSUB1 MISSION shRNA Bacterial Glycerol Stock
WD repeat, sterile alpha motif and U-box domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-692s21c1
Sequence:CCGGTGGAATTACCTGCTGCGATTTCTCGAGAAATCGCAGCAGGTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1477s21c1
Sequence:CCGGGTACAAGTCCCATGACAAATCCTCGAGGATTTGTCATGGGACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1511s21c1
Sequence:CCGGAGCGGTACTTACACCAAATAGCTCGAGCTATTTGGTGTAAGTACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-247s21c1
Sequence:CCGGCAATTCGCCTGTACTCGTTACCTCGAGGTAACGAGTACAGGCGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152528.2-1635s21c1
Sequence:CCGGAGGTAAATACTAATCAGACATCTCGAGATGTCTGATTAGTATTTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1124s21c1
Sequence:CCGGGAAGCAATTTACCGAAGATTGCTCGAGCAATCTTCGGTAAATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-927s21c1
Sequence:CCGGGATAAGTCTGTCATAGTATATCTCGAGATATACTATGACAGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1610s1c1
Sequence:CCGGCAGTGATCTCATTTGAATGATCTCGAGATCATTCAAATGAGATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152528.1-294s1c1
Sequence:CCGGCCATTGAAGTTTCATACCTATCTCGAGATAGGTATGAAACTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152528.1-1415s1c1
Sequence:CCGGCGCATCAGATGGCTATTCATACTCGAGTATGAATAGCCATCTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1333s1c1
Sequence:CCGGCCAAGGTTAAATCCCTTTCTTCTCGAGAAGAAAGGGATTTAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1296s1c1
Sequence:CCGGCGTAGTAAAGTGCTGAGGAAACTCGAGTTTCCTCAGCACTTTACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152528
VALIDATED
WDSUB1 MISSION shRNA shRNA Plasmid DNA
WD repeat, sterile alpha motif and U-box domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-692s21c1
Sequence:CCGGTGGAATTACCTGCTGCGATTTCTCGAGAAATCGCAGCAGGTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1477s21c1
Sequence:CCGGGTACAAGTCCCATGACAAATCCTCGAGGATTTGTCATGGGACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1511s21c1
Sequence:CCGGAGCGGTACTTACACCAAATAGCTCGAGCTATTTGGTGTAAGTACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-247s21c1
Sequence:CCGGCAATTCGCCTGTACTCGTTACCTCGAGGTAACGAGTACAGGCGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152528.2-1635s21c1
Sequence:CCGGAGGTAAATACTAATCAGACATCTCGAGATGTCTGATTAGTATTTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1124s21c1
Sequence:CCGGGAAGCAATTTACCGAAGATTGCTCGAGCAATCTTCGGTAAATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-927s21c1
Sequence:CCGGGATAAGTCTGTCATAGTATATCTCGAGATATACTATGACAGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1610s1c1
Sequence:CCGGCAGTGATCTCATTTGAATGATCTCGAGATCATTCAAATGAGATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152528.1-294s1c1
Sequence:CCGGCCATTGAAGTTTCATACCTATCTCGAGATAGGTATGAAACTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152528.1-1415s1c1
Sequence:CCGGCGCATCAGATGGCTATTCATACTCGAGTATGAATAGCCATCTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1333s1c1
Sequence:CCGGCCAAGGTTAAATCCCTTTCTTCTCGAGAAGAAAGGGATTTAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1296s1c1
Sequence:CCGGCGTAGTAAAGTGCTGAGGAAACTCGAGTTTCCTCAGCACTTTACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152528
VALIDATED
WDSUB1 MISSION shRNA Lentiviral Transduction Particles
WD repeat, sterile alpha motif and U-box domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-692s21c1
Sequence:CCGGTGGAATTACCTGCTGCGATTTCTCGAGAAATCGCAGCAGGTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1477s21c1
Sequence:CCGGGTACAAGTCCCATGACAAATCCTCGAGGATTTGTCATGGGACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1511s21c1
Sequence:CCGGAGCGGTACTTACACCAAATAGCTCGAGCTATTTGGTGTAAGTACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-247s21c1
Sequence:CCGGCAATTCGCCTGTACTCGTTACCTCGAGGTAACGAGTACAGGCGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152528.2-1635s21c1
Sequence:CCGGAGGTAAATACTAATCAGACATCTCGAGATGTCTGATTAGTATTTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-1124s21c1
Sequence:CCGGGAAGCAATTTACCGAAGATTGCTCGAGCAATCTTCGGTAAATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152528.2-927s21c1
Sequence:CCGGGATAAGTCTGTCATAGTATATCTCGAGATATACTATGACAGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1610s1c1
Sequence:CCGGCAGTGATCTCATTTGAATGATCTCGAGATCATTCAAATGAGATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152528.1-294s1c1
Sequence:CCGGCCATTGAAGTTTCATACCTATCTCGAGATAGGTATGAAACTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152528.1-1415s1c1
Sequence:CCGGCGCATCAGATGGCTATTCATACTCGAGTATGAATAGCCATCTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1333s1c1
Sequence:CCGGCCAAGGTTAAATCCCTTTCTTCTCGAGAAGAAAGGGATTTAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152528.1-1296s1c1
Sequence:CCGGCGTAGTAAAGTGCTGAGGAAACTCGAGTTTCCTCAGCACTTTACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028118
VALIDATED
WDSUB1 MISSION shRNA Bacterial Glycerol Stock
WD repeat, sterile alpha motif and U-box domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-584s1c1
Sequence:CCGGCACAGACATACAAACTATATACTCGAGTATATAGTTTGTATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1352s21c1
Sequence:CCGGGCAAAGTCCTGAGGAGTATTGCTCGAGCAATACTCCTCAGGACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-613s21c1
Sequence:CCGGAGTGTCAAGGATAGCTCATTGCTCGAGCAATGAGCTATCCTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028118.1-1641s21c1
Sequence:CCGGACAGGCATCGGATCCACTTTCCTCGAGGAAAGTGGATCCGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1238s21c1
Sequence:CCGGTGGAAGACCTCGTCGGTATTTCTCGAGAAATACCGACGAGGTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1418s21c1
Sequence:CCGGACGAGTTCATCTGCCCAATAACTCGAGTTATTGGGCAGATGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-1385s1c1
Sequence:CCGGCCAAGATGGATTCCCTCTCTTCTCGAGAAGAGAGGGAATCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-979s1c1
Sequence:CCGGGTGGATAAATCTGTCATCATACTCGAGTATGATGACAGATTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028118
VALIDATED
WDSUB1 MISSION shRNA shRNA Plasmid DNA
WD repeat, sterile alpha motif and U-box domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-584s1c1
Sequence:CCGGCACAGACATACAAACTATATACTCGAGTATATAGTTTGTATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1352s21c1
Sequence:CCGGGCAAAGTCCTGAGGAGTATTGCTCGAGCAATACTCCTCAGGACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-613s21c1
Sequence:CCGGAGTGTCAAGGATAGCTCATTGCTCGAGCAATGAGCTATCCTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028118.1-1641s21c1
Sequence:CCGGACAGGCATCGGATCCACTTTCCTCGAGGAAAGTGGATCCGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1238s21c1
Sequence:CCGGTGGAAGACCTCGTCGGTATTTCTCGAGAAATACCGACGAGGTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1418s21c1
Sequence:CCGGACGAGTTCATCTGCCCAATAACTCGAGTTATTGGGCAGATGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-1385s1c1
Sequence:CCGGCCAAGATGGATTCCCTCTCTTCTCGAGAAGAGAGGGAATCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-979s1c1
Sequence:CCGGGTGGATAAATCTGTCATCATACTCGAGTATGATGACAGATTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028118
VALIDATED
WDSUB1 MISSION shRNA Lentiviral Transduction Particles
WD repeat, sterile alpha motif and U-box domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-584s1c1
Sequence:CCGGCACAGACATACAAACTATATACTCGAGTATATAGTTTGTATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1352s21c1
Sequence:CCGGGCAAAGTCCTGAGGAGTATTGCTCGAGCAATACTCCTCAGGACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-613s21c1
Sequence:CCGGAGTGTCAAGGATAGCTCATTGCTCGAGCAATGAGCTATCCTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028118.1-1641s21c1
Sequence:CCGGACAGGCATCGGATCCACTTTCCTCGAGGAAAGTGGATCCGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1238s21c1
Sequence:CCGGTGGAAGACCTCGTCGGTATTTCTCGAGAAATACCGACGAGGTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028118.1-1418s21c1
Sequence:CCGGACGAGTTCATCTGCCCAATAACTCGAGTTATTGGGCAGATGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-1385s1c1
Sequence:CCGGCCAAGATGGATTCCCTCTCTTCTCGAGAAGAGAGGGAATCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028118.1-979s1c1
Sequence:CCGGGTGGATAAATCTGTCATCATACTCGAGTATGATGACAGATTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks