EMAIL THIS PAGE TO A FRIEND

WDTC1

WD and tetratricopeptide repeats 1

Synonyms: ADP DCAF9
UniProtKB ID: Q8N5D0, D3DPL5, Q5SSC5, Q9NV87, Q9UPW4
Gene ID:
Mouse(230796) WD and tetratricopeptide repeats 1
Rat(313020) WD and tetratricopeptide repeats 1
domestic guinea pig(100725211) WD and tetratricopeptide repeats 1
Domestic Rabbit(100356642) WD and tetratricopeptide repeats 1
naked mole-rat(101725803) WD and tetratricopeptide repeats 1
cow(789937) WD and tetratricopeptide repeats 1
sheep(101108289) WD and tetratricopeptide repeats 1
Zebrafish(570606) WD and tetratricopeptide repeats 1
chicken(419581) WD and tetratricopeptide repeats 1
dog(487347) WD and tetratricopeptide repeats 1
Horse(100056964) WD and tetratricopeptide repeats 1
domestic cat(101089026) WD and tetratricopeptide repeats 1
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015023 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073691 MISSION® esiRNA esiRNA targeting mouse Wdtc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015023 Rosetta Predictions human pricing
NM_001107908 Rosetta Predictions rat pricing
NM_199306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346816 predicted 1535
2 SASI_Hs01_00197348 predicted 1578
3 SASI_Hs01_00197349 predicted 462
4 SASI_Hs01_00197350 predicted 1571
5 SASI_Hs01_00197351 predicted 1469
6 SASI_Hs01_00197352 predicted 2000
7 SASI_Hs01_00197353 predicted 860
8 SASI_Hs01_00197354 predicted 2000
9 SASI_Hs01_00197355 predicted 666
10 SASI_Hs01_00197356 predicted 1470
11 SASI_Hs01_00197357 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233465 predicted 1350
2 SASI_Rn02_00233466 predicted 444
3 SASI_Rn02_00233467 predicted 996
4 SASI_Rn02_00233468 predicted 1370
5 SASI_Rn02_00233469 predicted 1016
6 SASI_Rn02_00233470 predicted 2103
7 SASI_Rn02_00233471 predicted 753
8 SASI_Rn02_00233472 predicted 1343
9 SASI_Rn02_00233473 predicted 1158
10 SASI_Rn02_00233474 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133621 predicted 1831
2 SASI_Mm01_00133622 predicted 1294
3 SASI_Mm02_00351433 predicted 935
4 SASI_Mm01_00133624 predicted 478
5 SASI_Mm01_00133623 predicted 1032
6 SASI_Mm01_00133626 predicted 1410
7 SASI_Mm02_00351434 predicted 1152
8 SASI_Mm02_00351435 predicted 1498
9 SASI_Mm01_00133628 predicted 2088
10 SASI_Mm01_00133629 predicted 1310
11 SASI_Mm01_00133625 predicted 685
12 SASI_Mm01_00133627 predicted 283
13 SASI_Mm01_00133630 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199306
VALIDATED
WDTC1 MISSION shRNA Bacterial Glycerol Stock
WD and tetratricopeptide repeats 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199306.1-954s1c1
Sequence:CCGGGCAGTATTATGTCGCAGGTCACTCGAGTGACCTGCGACATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-1312s21c1
Sequence:CCGGCTTACAAGCAACGGCCATATACTCGAGTATATGGCCGTTGCTTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-718s21c1
Sequence:CCGGCTCATGCTGGAGACCGCATTTCTCGAGAAATGCGGTCTCCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199306.4-2019s21c1
Sequence:CCGGTGCAACACCACCACGGATATCCTCGAGGATATCCGTGGTGGTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199306.4-1312s1c1
Sequence:CCGGCTTACAAGCAACGGCCATATACTCGAGTATATGGCCGTTGCTTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-481s21c1
Sequence:CCGGTGAGCTTTGAACGGCGATATCCTCGAGGATATCGCCGTTCAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-3815s21c1
Sequence:CCGGCTTGGTAATGAAGTGTATTTACTCGAGTAAATACACTTCATTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199306
VALIDATED
WDTC1 MISSION shRNA shRNA Plasmid DNA
WD and tetratricopeptide repeats 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199306.1-954s1c1
Sequence:CCGGGCAGTATTATGTCGCAGGTCACTCGAGTGACCTGCGACATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-1312s21c1
Sequence:CCGGCTTACAAGCAACGGCCATATACTCGAGTATATGGCCGTTGCTTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-718s21c1
Sequence:CCGGCTCATGCTGGAGACCGCATTTCTCGAGAAATGCGGTCTCCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199306.4-2019s21c1
Sequence:CCGGTGCAACACCACCACGGATATCCTCGAGGATATCCGTGGTGGTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199306.4-1312s1c1
Sequence:CCGGCTTACAAGCAACGGCCATATACTCGAGTATATGGCCGTTGCTTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-481s21c1
Sequence:CCGGTGAGCTTTGAACGGCGATATCCTCGAGGATATCGCCGTTCAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-3815s21c1
Sequence:CCGGCTTGGTAATGAAGTGTATTTACTCGAGTAAATACACTTCATTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199306
VALIDATED
WDTC1 MISSION shRNA Lentiviral Transduction Particles
WD and tetratricopeptide repeats 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199306.1-954s1c1
Sequence:CCGGGCAGTATTATGTCGCAGGTCACTCGAGTGACCTGCGACATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-1312s21c1
Sequence:CCGGCTTACAAGCAACGGCCATATACTCGAGTATATGGCCGTTGCTTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-718s21c1
Sequence:CCGGCTCATGCTGGAGACCGCATTTCTCGAGAAATGCGGTCTCCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199306.4-2019s21c1
Sequence:CCGGTGCAACACCACCACGGATATCCTCGAGGATATCCGTGGTGGTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199306.4-1312s1c1
Sequence:CCGGCTTACAAGCAACGGCCATATACTCGAGTATATGGCCGTTGCTTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-481s21c1
Sequence:CCGGTGAGCTTTGAACGGCGATATCCTCGAGGATATCGCCGTTCAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199306.4-3815s21c1
Sequence:CCGGCTTGGTAATGAAGTGTATTTACTCGAGTAAATACACTTCATTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015023
VALIDATED
WDTC1 MISSION shRNA Bacterial Glycerol Stock
WD and tetratricopeptide repeats 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015023.2-1403s1c1
Sequence:CCGGGCACCTTCATAGCAATGGCTTCTCGAGAAGCCATTGCTATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015023.2-1352s1c1
Sequence:CCGGGAATGGCAAGATGTCCACCAACTCGAGTTGGTGGACATCTTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-1571s1c1
Sequence:CCGGCCCTCACAATGCCATGCTTTACTCGAGTAAAGCATGGCATTGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-3321s1c1
Sequence:CCGGCGCCACAAAGACCAAAGAAGTCTCGAGACTTCTTTGGTCTTTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-1041s1c1
Sequence:CCGGCGCATGATCCATAACCACAGACTCGAGTCTGTGGTTATGGATCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-3532s1c1
Sequence:CCGGCCAGGTAGTTGGTTCATCCTTCTCGAGAAGGATGAACCAACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015023.2-1457s1c1
Sequence:CCGGCCAAGTAGAGCTACCACCATACTCGAGTATGGTGGTAGCTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-1761s1c1
Sequence:CCGGCTGGACGACTTCAAAGGGAAACTCGAGTTTCCCTTTGAAGTCGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-2074s1c1
Sequence:CCGGGCTCCTTCTTCATCTGGGAAACTCGAGTTTCCCAGATGAAGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015023.2-917s1c1
Sequence:CCGGGCTGATTGACCTGACAGAGTACTCGAGTACTCTGTCAGGTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015023.2-1485s1c1
Sequence:CCGGCGTGTGAAACAGCAAGCCAATCTCGAGATTGGCTTGCTGTTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015023.2-668s1c1
Sequence:CCGGCGCAAATATCTTCTCTGTCAACTCGAGTTGACAGAGAAGATATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015023
VALIDATED
WDTC1 MISSION shRNA shRNA Plasmid DNA
WD and tetratricopeptide repeats 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015023.2-1403s1c1
Sequence:CCGGGCACCTTCATAGCAATGGCTTCTCGAGAAGCCATTGCTATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015023.2-1352s1c1
Sequence:CCGGGAATGGCAAGATGTCCACCAACTCGAGTTGGTGGACATCTTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-1571s1c1
Sequence:CCGGCCCTCACAATGCCATGCTTTACTCGAGTAAAGCATGGCATTGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-3321s1c1
Sequence:CCGGCGCCACAAAGACCAAAGAAGTCTCGAGACTTCTTTGGTCTTTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-1041s1c1
Sequence:CCGGCGCATGATCCATAACCACAGACTCGAGTCTGTGGTTATGGATCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-3532s1c1
Sequence:CCGGCCAGGTAGTTGGTTCATCCTTCTCGAGAAGGATGAACCAACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015023.2-1457s1c1
Sequence:CCGGCCAAGTAGAGCTACCACCATACTCGAGTATGGTGGTAGCTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-1761s1c1
Sequence:CCGGCTGGACGACTTCAAAGGGAAACTCGAGTTTCCCTTTGAAGTCGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-2074s1c1
Sequence:CCGGGCTCCTTCTTCATCTGGGAAACTCGAGTTTCCCAGATGAAGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015023.2-917s1c1
Sequence:CCGGGCTGATTGACCTGACAGAGTACTCGAGTACTCTGTCAGGTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015023.2-1485s1c1
Sequence:CCGGCGTGTGAAACAGCAAGCCAATCTCGAGATTGGCTTGCTGTTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015023.2-668s1c1
Sequence:CCGGCGCAAATATCTTCTCTGTCAACTCGAGTTGACAGAGAAGATATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015023
VALIDATED
WDTC1 MISSION shRNA Lentiviral Transduction Particles
WD and tetratricopeptide repeats 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015023.2-1403s1c1
Sequence:CCGGGCACCTTCATAGCAATGGCTTCTCGAGAAGCCATTGCTATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015023.2-1352s1c1
Sequence:CCGGGAATGGCAAGATGTCCACCAACTCGAGTTGGTGGACATCTTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-1571s1c1
Sequence:CCGGCCCTCACAATGCCATGCTTTACTCGAGTAAAGCATGGCATTGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-3321s1c1
Sequence:CCGGCGCCACAAAGACCAAAGAAGTCTCGAGACTTCTTTGGTCTTTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-1041s1c1
Sequence:CCGGCGCATGATCCATAACCACAGACTCGAGTCTGTGGTTATGGATCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-3532s1c1
Sequence:CCGGCCAGGTAGTTGGTTCATCCTTCTCGAGAAGGATGAACCAACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015023.2-1457s1c1
Sequence:CCGGCCAAGTAGAGCTACCACCATACTCGAGTATGGTGGTAGCTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015023.2-1761s1c1
Sequence:CCGGCTGGACGACTTCAAAGGGAAACTCGAGTTTCCCTTTGAAGTCGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015023.2-2074s1c1
Sequence:CCGGGCTCCTTCTTCATCTGGGAAACTCGAGTTTCCCAGATGAAGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015023.2-917s1c1
Sequence:CCGGGCTGATTGACCTGACAGAGTACTCGAGTACTCTGTCAGGTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015023.2-1485s1c1
Sequence:CCGGCGTGTGAAACAGCAAGCCAATCTCGAGATTGGCTTGCTGTTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015023.2-668s1c1
Sequence:CCGGCGCAAATATCTTCTCTGTCAACTCGAGTTGACAGAGAAGATATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks