EMAIL THIS PAGE TO A FRIEND

WDYHV1

WDYHV motif containing 1

Synonyms: C8orf32
UniProtKB ID: Q96HA8, Q9NW95
Gene ID:
Mouse(76773) WDYHV motif containing 1
Rat(362914) WDYHV motif containing 1
Zebrafish(560935) WDYHV motif containing 1
chicken(420345) WDYHV motif containing 1
domestic cat(101080427) WDYHV motif containing 1
dog(609297) WDYHV motif containing 1
cow(510463) WDYHV motif containing 1
naked mole-rat(101719072) WDYHV motif containing 1
domestic guinea pig(100736007) WDYHV motif containing 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144851 MISSION® esiRNA esiRNA human WDYHV1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018024 Rosetta Predictions human pricing
NM_001025024 Rosetta Predictions rat pricing
NM_029734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351125 predicted 690
2 SASI_Hs01_00133860 predicted 834
3 SASI_Hs01_00133861 predicted 804
4 SASI_Hs01_00133862 predicted 819
5 SASI_Hs01_00133864 predicted 484
6 SASI_Hs01_00133865 predicted 442
7 SASI_Hs01_00133866 predicted 604
8 SASI_Hs01_00133868 predicted 700
9 SASI_Hs01_00133869 predicted 398
10 SASI_Hs02_00351126 predicted 660
11 SASI_Hs01_00133863 predicted 736
12 SASI_Hs01_00133867 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046334 predicted 1157
2 SASI_Rn01_00046335 predicted 588
3 SASI_Rn01_00046336 predicted 544
4 SASI_Rn01_00046337 predicted 511
5 SASI_Rn01_00046338 predicted 1142
6 SASI_Rn01_00046339 predicted 462
7 SASI_Rn01_00046340 predicted 426
8 SASI_Rn01_00046341 predicted 289
9 SASI_Rn01_00046342 predicted 1181
10 SASI_Rn01_00046343 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187886 predicted 789
2 SASI_Mm01_00187887 predicted 647
3 SASI_Mm01_00187888 predicted 425
4 SASI_Mm01_00187889 predicted 765
5 SASI_Mm01_00187890 predicted 783
6 SASI_Mm01_00187891 predicted 420
7 SASI_Mm01_00187892 predicted 441
8 SASI_Mm01_00187893 predicted 778
9 SASI_Mm01_00187894 predicted 772
10 SASI_Mm02_00335825 predicted 302
11 SASI_Mm01_00187895 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018024
VALIDATED
WDYHV1 MISSION shRNA Bacterial Glycerol Stock
WDYHV motif containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-345s21c1
Sequence:CCGGGGACCTGTGATCTGGGATTACCTCGAGGTAATCCCAGATCACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-694s21c1
Sequence:CCGGTCTACACACTATCCGAATTTACTCGAGTAAATTCGGATAGTGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018024.1-1136s21c1
Sequence:CCGGTGAATCTCAAATGCCCATAAACTCGAGTTTATGGGCATTTGAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-665s21c1
Sequence:CCGGTATGGATCCCAAGGTAGGATGCTCGAGCATCCTACCTTGGGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-274s21c1
Sequence:CCGGGTTATGCTGTCTTCATATCTACTCGAGTAGATATGAAGACAGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-521s21c1
Sequence:CCGGGATCCGTGCAGATTCATATTTCTCGAGAAATATGAATCTGCACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-496s21c1
Sequence:CCGGCACAGTTTAGGAGGAAATTTACTCGAGTAAATTTCCTCCTAAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-417s1c1
Sequence:CCGGCTCGATACTGTCTTGCCATTTCTCGAGAAATGGCAAGACAGTATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-462s1c1
Sequence:CCGGGAAGATGCCTTTAAGTCTGATCTCGAGATCAGACTTAAAGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-985s1c1
Sequence:CCGGCGTTACAACACGAGGACTTAACTCGAGTTAAGTCCTCGTGTTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-984s1c1
Sequence:CCGGGCGTTACAACACGAGGACTTACTCGAGTAAGTCCTCGTGTTGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018024
VALIDATED
WDYHV1 MISSION shRNA shRNA Plasmid DNA
WDYHV motif containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-345s21c1
Sequence:CCGGGGACCTGTGATCTGGGATTACCTCGAGGTAATCCCAGATCACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-694s21c1
Sequence:CCGGTCTACACACTATCCGAATTTACTCGAGTAAATTCGGATAGTGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018024.1-1136s21c1
Sequence:CCGGTGAATCTCAAATGCCCATAAACTCGAGTTTATGGGCATTTGAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-665s21c1
Sequence:CCGGTATGGATCCCAAGGTAGGATGCTCGAGCATCCTACCTTGGGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-274s21c1
Sequence:CCGGGTTATGCTGTCTTCATATCTACTCGAGTAGATATGAAGACAGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-521s21c1
Sequence:CCGGGATCCGTGCAGATTCATATTTCTCGAGAAATATGAATCTGCACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-496s21c1
Sequence:CCGGCACAGTTTAGGAGGAAATTTACTCGAGTAAATTTCCTCCTAAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-417s1c1
Sequence:CCGGCTCGATACTGTCTTGCCATTTCTCGAGAAATGGCAAGACAGTATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-462s1c1
Sequence:CCGGGAAGATGCCTTTAAGTCTGATCTCGAGATCAGACTTAAAGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-985s1c1
Sequence:CCGGCGTTACAACACGAGGACTTAACTCGAGTTAAGTCCTCGTGTTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-984s1c1
Sequence:CCGGGCGTTACAACACGAGGACTTACTCGAGTAAGTCCTCGTGTTGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018024
VALIDATED
WDYHV1 MISSION shRNA Lentiviral Transduction Particles
WDYHV motif containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-345s21c1
Sequence:CCGGGGACCTGTGATCTGGGATTACCTCGAGGTAATCCCAGATCACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-694s21c1
Sequence:CCGGTCTACACACTATCCGAATTTACTCGAGTAAATTCGGATAGTGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018024.1-1136s21c1
Sequence:CCGGTGAATCTCAAATGCCCATAAACTCGAGTTTATGGGCATTTGAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-665s21c1
Sequence:CCGGTATGGATCCCAAGGTAGGATGCTCGAGCATCCTACCTTGGGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-274s21c1
Sequence:CCGGGTTATGCTGTCTTCATATCTACTCGAGTAGATATGAAGACAGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-521s21c1
Sequence:CCGGGATCCGTGCAGATTCATATTTCTCGAGAAATATGAATCTGCACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018024.1-496s21c1
Sequence:CCGGCACAGTTTAGGAGGAAATTTACTCGAGTAAATTTCCTCCTAAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-417s1c1
Sequence:CCGGCTCGATACTGTCTTGCCATTTCTCGAGAAATGGCAAGACAGTATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-462s1c1
Sequence:CCGGGAAGATGCCTTTAAGTCTGATCTCGAGATCAGACTTAAAGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-985s1c1
Sequence:CCGGCGTTACAACACGAGGACTTAACTCGAGTTAAGTCCTCGTGTTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018024.1-984s1c1
Sequence:CCGGGCGTTACAACACGAGGACTTACTCGAGTAAGTCCTCGTGTTGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029734
WDYHV1 MISSION shRNA Bacterial Glycerol Stock
WDYHV motif containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029734.1-915s1c1
Sequence:CCGGCCCAGCCTCAGACATAGATATCTCGAGATATCTATGTCTGAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-142s1c1
Sequence:CCGGACAGCTGCTATTGTGAGGAAACTCGAGTTTCCTCACAATAGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-179s1c1
Sequence:CCGGTGAGTACATCAAGACACACAACTCGAGTTGTGTGTCTTGATGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-220s1c1
Sequence:CCGGGCTATGCAGTCTTCATATCAACTCGAGTTGATATGAAGACTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-481s1c1
Sequence:CCGGCCTACTTGAAGCACTTCGCTTCTCGAGAAGCGAAGTGCTTCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029734
WDYHV1 MISSION shRNA shRNA Plasmid DNA
WDYHV motif containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029734.1-915s1c1
Sequence:CCGGCCCAGCCTCAGACATAGATATCTCGAGATATCTATGTCTGAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-142s1c1
Sequence:CCGGACAGCTGCTATTGTGAGGAAACTCGAGTTTCCTCACAATAGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-179s1c1
Sequence:CCGGTGAGTACATCAAGACACACAACTCGAGTTGTGTGTCTTGATGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-220s1c1
Sequence:CCGGGCTATGCAGTCTTCATATCAACTCGAGTTGATATGAAGACTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-481s1c1
Sequence:CCGGCCTACTTGAAGCACTTCGCTTCTCGAGAAGCGAAGTGCTTCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029734
WDYHV1 MISSION shRNA Lentiviral Transduction Particles
WDYHV motif containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029734.1-915s1c1
Sequence:CCGGCCCAGCCTCAGACATAGATATCTCGAGATATCTATGTCTGAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-142s1c1
Sequence:CCGGACAGCTGCTATTGTGAGGAAACTCGAGTTTCCTCACAATAGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-179s1c1
Sequence:CCGGTGAGTACATCAAGACACACAACTCGAGTTGTGTGTCTTGATGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-220s1c1
Sequence:CCGGGCTATGCAGTCTTCATATCAACTCGAGTTGATATGAAGACTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029734.1-481s1c1
Sequence:CCGGCCTACTTGAAGCACTTCGCTTCTCGAGAAGCGAAGTGCTTCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks