EMAIL THIS PAGE TO A FRIEND

WEE1

WEE1 homolog (S. pombe)

Synonyms: WEE1A WEE1hu
UniProtKB ID: P30291, B3KVE1, D3DQV0
Gene ID:
Human(7465) Summary: This gene encodes a nuclear protein, which is a tyrosine kinase belonging to the Ser/Thr family of protein kinases. This protein catalyzes the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase, and appears to coordinate the transition between DNA replication and mitosis by protecting the nucleus from cytoplasmically activated CDC2 kinase. [provided by RefSeq, Jul 2008]
Mouse(22390) WEE 1 homolog 1 (S. pombe)
Rat(308937) wee 1 homolog (S. pombe)
Thale Cress(839453) Wee1-like protein kinase
dog(476847) WEE1 homolog (S. pombe)
domestic cat(101091897) WEE1 homolog (S. pombe)
Horse(100071182) WEE1 homolog (S. pombe)
Zebrafish(327060) WEE1 homolog (S. pombe)
chicken(423045) WEE1 homolog (S. pombe)
cow(540322) WEE1 homolog (S. pombe)
domestic guinea pig(100726821) WEE1 homolog (S. pombe)
naked mole-rat(101704354) WEE1 homolog (S. pombe)
Domestic Rabbit(100345730) WEE1 homolog (S. pombe)
199 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003390 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003390 Rosetta Predictions human pricing
NM_001012742 Rosetta Predictions rat pricing
NM_009516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226779 predicted 2528
2 SASI_Hs02_00335570 predicted 2210
3 SASI_Hs01_00226780 predicted 2876
4 SASI_Hs01_00226782 predicted 2869
5 SASI_Hs01_00226783 predicted 2492
6 SASI_Hs01_00226785 predicted 1895
7 SASI_Hs01_00226786 predicted 2486
8 SASI_Hs02_00335571 predicted 2723
9 SASI_Hs01_00226787 predicted 2339
10 SASI_Hs01_00226788 predicted 2285
11 SASI_Hs01_00226781 predicted 2701
12 SASI_Hs01_00226784 predicted 1915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082464 predicted 730
2 SASI_Rn01_00082465 predicted 1168
3 SASI_Rn01_00082466 predicted 1194
4 SASI_Rn01_00082467 predicted 1413
5 SASI_Rn01_00082468 predicted 1792
6 SASI_Rn01_00082469 predicted 659
7 SASI_Rn01_00082470 predicted 940
8 SASI_Rn01_00082472 predicted 931
9 SASI_Rn01_00082473 predicted 603
10 SASI_Rn02_00200601 predicted 918
11 SASI_Rn01_00082471 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122232 predicted 1167
2 SASI_Mm01_00122233 predicted 1689
3 SASI_Mm02_00316314 predicted 992
4 SASI_Mm01_00122234 predicted 877
5 SASI_Mm01_00122235 predicted 960
6 SASI_Mm01_00122236 predicted 1623
7 SASI_Mm01_00122237 predicted 1966
8 SASI_Mm01_00122238 predicted 2019
9 SASI_Mm01_00122240 predicted 2027
10 SASI_Mm01_00122241 predicted 1425
11 SASI_Mm01_00122239 predicted 1658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003390
VALIDATED
WEE1 MISSION shRNA Bacterial Glycerol Stock
WEE1 homolog (S. pombe)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003390.2-4016s1c1
Sequence:CCGGGCTGTTTGAAATGCCAGAATGCTCGAGCATTCTGGCATTTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003390.2-2007s1c1
Sequence:CCGGGCAATATGAAGTCCCGGTATACTCGAGTATACCGGGACTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003390.2-2286s1c1
Sequence:CCGGGAAGTTTAGCTGATGCTATAACTCGAGTTATAGCATCAGCTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_003390.2-3652s1c1
Sequence:CCGGGCTGTAAACTTGTAGCATTAACTCGAGTTAATGCTACAAGTTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003390.2-1713s1c1
Sequence:CCGGCCAAGAGTTTGCTCTCCAAAGCTCGAGCTTTGGAGAGCAAACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003390.2-1859s1c1
Sequence:CCGGCCGGATTCTTTGTTGCTTCATCTCGAGATGAAGCAACAAAGAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-1946s1c1
Sequence:CCGGGCCAGTGATTATGAGCTTGAACTCGAGTTCAAGCTCATAATCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-3616s1c1
Sequence:CCGGGCCTTGTGAATTTGCTGCTATCTCGAGATAGCAGCAAATTCACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-3009s1c1
Sequence:CCGGCCACCCAGAGTAATAGAACATCTCGAGATGTTCTATTACTCTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-2859s1c1
Sequence:CCGGCTAGAAAGAGTGCAGAACAATCTCGAGATTGTTCTGCACTCTTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-2209s21c1
Sequence:CCGGTTCTCATGTAGTTCGATATTTCTCGAGAAATATCGAACTACATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-3019s21c1
Sequence:CCGGTAATAGAACATCTCGACTTATCTCGAGATAAGTCGAGATGTTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003390.2-2103s21c1
Sequence:GTACCGGATGGATGCATTTATGCCATTACTCGAGTAATGGCATAAATGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-3987s21c1
Sequence:GTACCGGATAAACCGATCTTCGTGATACCTCGAGGTATCACGAAGATCGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-2236s21c1
Sequence:CCGGGTGGGCAGAAGATGATCATATCTCGAGATATGATCATCTTCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003390
VALIDATED
WEE1 MISSION shRNA shRNA Plasmid DNA
WEE1 homolog (S. pombe)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003390.2-4016s1c1
Sequence:CCGGGCTGTTTGAAATGCCAGAATGCTCGAGCATTCTGGCATTTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003390.2-2007s1c1
Sequence:CCGGGCAATATGAAGTCCCGGTATACTCGAGTATACCGGGACTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003390.2-2286s1c1
Sequence:CCGGGAAGTTTAGCTGATGCTATAACTCGAGTTATAGCATCAGCTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_003390.2-3652s1c1
Sequence:CCGGGCTGTAAACTTGTAGCATTAACTCGAGTTAATGCTACAAGTTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003390.2-1713s1c1
Sequence:CCGGCCAAGAGTTTGCTCTCCAAAGCTCGAGCTTTGGAGAGCAAACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003390.2-1859s1c1
Sequence:CCGGCCGGATTCTTTGTTGCTTCATCTCGAGATGAAGCAACAAAGAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-1946s1c1
Sequence:CCGGGCCAGTGATTATGAGCTTGAACTCGAGTTCAAGCTCATAATCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-3616s1c1
Sequence:CCGGGCCTTGTGAATTTGCTGCTATCTCGAGATAGCAGCAAATTCACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-3009s1c1
Sequence:CCGGCCACCCAGAGTAATAGAACATCTCGAGATGTTCTATTACTCTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-2859s1c1
Sequence:CCGGCTAGAAAGAGTGCAGAACAATCTCGAGATTGTTCTGCACTCTTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-2209s21c1
Sequence:CCGGTTCTCATGTAGTTCGATATTTCTCGAGAAATATCGAACTACATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-3019s21c1
Sequence:CCGGTAATAGAACATCTCGACTTATCTCGAGATAAGTCGAGATGTTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003390.2-2103s21c1
Sequence:GTACCGGATGGATGCATTTATGCCATTACTCGAGTAATGGCATAAATGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-3987s21c1
Sequence:GTACCGGATAAACCGATCTTCGTGATACCTCGAGGTATCACGAAGATCGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-2236s21c1
Sequence:CCGGGTGGGCAGAAGATGATCATATCTCGAGATATGATCATCTTCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003390
VALIDATED
WEE1 MISSION shRNA Lentiviral Transduction Particles
WEE1 homolog (S. pombe)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003390.2-4016s1c1
Sequence:CCGGGCTGTTTGAAATGCCAGAATGCTCGAGCATTCTGGCATTTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003390.2-2007s1c1
Sequence:CCGGGCAATATGAAGTCCCGGTATACTCGAGTATACCGGGACTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003390.2-2286s1c1
Sequence:CCGGGAAGTTTAGCTGATGCTATAACTCGAGTTATAGCATCAGCTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_003390.2-3652s1c1
Sequence:CCGGGCTGTAAACTTGTAGCATTAACTCGAGTTAATGCTACAAGTTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003390.2-1713s1c1
Sequence:CCGGCCAAGAGTTTGCTCTCCAAAGCTCGAGCTTTGGAGAGCAAACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003390.2-1859s1c1
Sequence:CCGGCCGGATTCTTTGTTGCTTCATCTCGAGATGAAGCAACAAAGAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-1946s1c1
Sequence:CCGGGCCAGTGATTATGAGCTTGAACTCGAGTTCAAGCTCATAATCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-3616s1c1
Sequence:CCGGGCCTTGTGAATTTGCTGCTATCTCGAGATAGCAGCAAATTCACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-3009s1c1
Sequence:CCGGCCACCCAGAGTAATAGAACATCTCGAGATGTTCTATTACTCTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003390.x-2859s1c1
Sequence:CCGGCTAGAAAGAGTGCAGAACAATCTCGAGATTGTTCTGCACTCTTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-2209s21c1
Sequence:CCGGTTCTCATGTAGTTCGATATTTCTCGAGAAATATCGAACTACATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-3019s21c1
Sequence:CCGGTAATAGAACATCTCGACTTATCTCGAGATAAGTCGAGATGTTCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003390.2-2103s21c1
Sequence:GTACCGGATGGATGCATTTATGCCATTACTCGAGTAATGGCATAAATGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-3987s21c1
Sequence:GTACCGGATAAACCGATCTTCGTGATACCTCGAGGTATCACGAAGATCGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003390.2-2236s21c1
Sequence:CCGGGTGGGCAGAAGATGATCATATCTCGAGATATGATCATCTTCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009516
VALIDATED
WEE1 MISSION shRNA Bacterial Glycerol Stock
WEE1 homolog (S. pombe)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-2036s1c1
Sequence:CCGGGCAGAGCAGTTACGAATAGAACTCGAGTTCTATTCGTAACTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009516.2-2178s1c1
Sequence:CCGGCCACCCAGAGTAATAGAACTTCTCGAGAAGTTCTATTACTCTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-1173s1c1
Sequence:CCGGGCAACATGAAGTCACGGTATACTCGAGTATACCGTGACTTCATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-1647s1c1
Sequence:CCGGGAGATGAAGATGACTGGATATCTCGAGATATCCAGTCATCTTCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-892s1c1
Sequence:CCGGGCTTTCCAAAGCGCGAGTTATCTCGAGATAACTCGCGCTTTGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1154s21c2
Sequence:CCGGGCAACATGAAGTCACGGTATACTCGAGTATACCGTGACTTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009516.3-2308s21c1
Sequence:CCGGCTAGAGCCCACTTCGTGATTACTCGAGTAATCACGAAGTGGGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1550s21c1
Sequence:CCGGCTTTGGTTCACATGGATATAACTCGAGTTATATCCATGTGAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1769s21c1
Sequence:CCGGATCTACCGAAAGCAGATATTTCTCGAGAAATATCTGCTTTCGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-2206s21c1
Sequence:CCGGCGCTCTGTCAGCCTTACTATACTCGAGTATAGTAAGGCTGACAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009516
VALIDATED
WEE1 MISSION shRNA shRNA Plasmid DNA
WEE1 homolog (S. pombe)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-2036s1c1
Sequence:CCGGGCAGAGCAGTTACGAATAGAACTCGAGTTCTATTCGTAACTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009516.2-2178s1c1
Sequence:CCGGCCACCCAGAGTAATAGAACTTCTCGAGAAGTTCTATTACTCTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-1173s1c1
Sequence:CCGGGCAACATGAAGTCACGGTATACTCGAGTATACCGTGACTTCATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-1647s1c1
Sequence:CCGGGAGATGAAGATGACTGGATATCTCGAGATATCCAGTCATCTTCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-892s1c1
Sequence:CCGGGCTTTCCAAAGCGCGAGTTATCTCGAGATAACTCGCGCTTTGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1154s21c2
Sequence:CCGGGCAACATGAAGTCACGGTATACTCGAGTATACCGTGACTTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009516.3-2308s21c1
Sequence:CCGGCTAGAGCCCACTTCGTGATTACTCGAGTAATCACGAAGTGGGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1550s21c1
Sequence:CCGGCTTTGGTTCACATGGATATAACTCGAGTTATATCCATGTGAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1769s21c1
Sequence:CCGGATCTACCGAAAGCAGATATTTCTCGAGAAATATCTGCTTTCGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-2206s21c1
Sequence:CCGGCGCTCTGTCAGCCTTACTATACTCGAGTATAGTAAGGCTGACAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009516
VALIDATED
WEE1 MISSION shRNA Lentiviral Transduction Particles
WEE1 homolog (S. pombe)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-2036s1c1
Sequence:CCGGGCAGAGCAGTTACGAATAGAACTCGAGTTCTATTCGTAACTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009516.2-2178s1c1
Sequence:CCGGCCACCCAGAGTAATAGAACTTCTCGAGAAGTTCTATTACTCTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-1173s1c1
Sequence:CCGGGCAACATGAAGTCACGGTATACTCGAGTATACCGTGACTTCATGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-1647s1c1
Sequence:CCGGGAGATGAAGATGACTGGATATCTCGAGATATCCAGTCATCTTCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009516.2-892s1c1
Sequence:CCGGGCTTTCCAAAGCGCGAGTTATCTCGAGATAACTCGCGCTTTGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1154s21c2
Sequence:CCGGGCAACATGAAGTCACGGTATACTCGAGTATACCGTGACTTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009516.3-2308s21c1
Sequence:CCGGCTAGAGCCCACTTCGTGATTACTCGAGTAATCACGAAGTGGGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1550s21c1
Sequence:CCGGCTTTGGTTCACATGGATATAACTCGAGTTATATCCATGTGAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-1769s21c1
Sequence:CCGGATCTACCGAAAGCAGATATTTCTCGAGAAATATCTGCTTTCGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009516.3-2206s21c1
Sequence:CCGGCGCTCTGTCAGCCTTACTATACTCGAGTATAGTAAGGCTGACAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks