EMAIL THIS PAGE TO A FRIEND

WEE2-AS1

WEE2 antisense RNA 1

Species: Human WEE2-AS1(285962)
Gene ID:
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173677 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011418 predicted 878
2 SASI_Hs01_00011419 predicted 976
3 SASI_Hs01_00011420 predicted 926
4 SASI_Hs01_00011421 predicted 859
5 SASI_Hs01_00011422 predicted 653
6 SASI_Hs01_00011423 predicted 905
7 SASI_Hs01_00011424 predicted 991
8 SASI_Hs01_00011425 predicted 679
9 SASI_Hs01_00011426 predicted 424
10 SASI_Hs01_00011427 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173677
WEE2-AS1 MISSION shRNA Bacterial Glycerol Stock
WEE2 antisense RNA 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-445s1c1
Sequence:CCGGGTTCTGATGATATAGGACCAACTCGAGTTGGTCCTATATCATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-578s1c1
Sequence:CCGGCTTCTATGACTCCAGAGGATTCTCGAGAATCCTCTGGAGTCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-477s1c1
Sequence:CCGGCAGAAGCTTCACTATTGGGAACTCGAGTTCCCAATAGTGAAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-600s1c1
Sequence:CCGGACTTTGCATCTTGTGACAAATCTCGAGATTTGTCACAAGATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173677.1-1578s1c1
Sequence:CCGGCTGGCCTTTATCACCAGAATGCTCGAGCATTCTGGTGATAAAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-462s1c1
Sequence:CCGGCCAAGAGGAAAGAAACAGAAGCTCGAGCTTCTGTTTCTTTCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173677.1-1391s1c1
Sequence:CCGGCAAGCAAGAAATGACACTTTCCTCGAGGAAAGTGTCATTTCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-271s1c1
Sequence:CCGGCCACATTTGGGAATATCACAGCTCGAGCTGTGATATTCCCAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-426s1c1
Sequence:CCGGCGGCATCAGGTTGGATCATGTCTCGAGACATGATCCAACCTGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173677
WEE2-AS1 MISSION shRNA shRNA Plasmid DNA
WEE2 antisense RNA 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-445s1c1
Sequence:CCGGGTTCTGATGATATAGGACCAACTCGAGTTGGTCCTATATCATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-578s1c1
Sequence:CCGGCTTCTATGACTCCAGAGGATTCTCGAGAATCCTCTGGAGTCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-477s1c1
Sequence:CCGGCAGAAGCTTCACTATTGGGAACTCGAGTTCCCAATAGTGAAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-600s1c1
Sequence:CCGGACTTTGCATCTTGTGACAAATCTCGAGATTTGTCACAAGATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173677.1-1578s1c1
Sequence:CCGGCTGGCCTTTATCACCAGAATGCTCGAGCATTCTGGTGATAAAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-462s1c1
Sequence:CCGGCCAAGAGGAAAGAAACAGAAGCTCGAGCTTCTGTTTCTTTCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173677.1-1391s1c1
Sequence:CCGGCAAGCAAGAAATGACACTTTCCTCGAGGAAAGTGTCATTTCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-271s1c1
Sequence:CCGGCCACATTTGGGAATATCACAGCTCGAGCTGTGATATTCCCAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-426s1c1
Sequence:CCGGCGGCATCAGGTTGGATCATGTCTCGAGACATGATCCAACCTGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173677
WEE2-AS1 MISSION shRNA Lentiviral Transduction Particles
WEE2 antisense RNA 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-445s1c1
Sequence:CCGGGTTCTGATGATATAGGACCAACTCGAGTTGGTCCTATATCATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-578s1c1
Sequence:CCGGCTTCTATGACTCCAGAGGATTCTCGAGAATCCTCTGGAGTCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-477s1c1
Sequence:CCGGCAGAAGCTTCACTATTGGGAACTCGAGTTCCCAATAGTGAAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-600s1c1
Sequence:CCGGACTTTGCATCTTGTGACAAATCTCGAGATTTGTCACAAGATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173677.1-1578s1c1
Sequence:CCGGCTGGCCTTTATCACCAGAATGCTCGAGCATTCTGGTGATAAAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-462s1c1
Sequence:CCGGCCAAGAGGAAAGAAACAGAAGCTCGAGCTTCTGTTTCTTTCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173677.1-1391s1c1
Sequence:CCGGCAAGCAAGAAATGACACTTTCCTCGAGGAAAGTGTCATTTCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-271s1c1
Sequence:CCGGCCACATTTGGGAATATCACAGCTCGAGCTGTGATATTCCCAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173677.1-426s1c1
Sequence:CCGGCGGCATCAGGTTGGATCATGTCTCGAGACATGATCCAACCTGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks