EMAIL THIS PAGE TO A FRIEND

WEE2

WEE1 homolog 2 (S. pombe)

Synonyms: WEE1B
UniProtKB ID: P0C1S8
Gene ID:
Mouse(381759) WEE1 homolog 2 (S. pombe)
Rat(502750) WEE1 homolog 2 (S. pombe)
naked mole-rat(101706756) WEE1 homolog 2 (S. pombe)
domestic guinea pig(100717213) WEE1 homolog 2 (S. pombe)
cow(520049) WEE1 homolog 2 (S. pombe)
sheep(101108648) WEE1 homolog 2 (S. pombe)
Zebrafish(327471) WEE1 homolog 2 (S. pombe)
chicken(427918) WEE1 homolog 2 (S. pombe)
Horse(100065530) WEE1 homolog 2 (S. pombe)
domestic cat(101093092) WEE1 homolog 2 (S. pombe)
dog(475525) WEE1 homolog 2 (S. pombe)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105558 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103211 MISSION® esiRNA esiRNA human WEE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105558 Rosetta Predictions human pricing
XM_001070431 Rosetta Predictions rat pricing
XM_578249 Rosetta Predictions rat pricing
NM_201370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324411 predicted 1058
2 SASI_Hs02_00324412 predicted 420
3 SASI_Hs02_00324413 predicted 1970
4 SASI_Hs02_00324414 predicted 1105
5 SASI_Hs02_00324415 predicted 1071
6 SASI_Hs02_00324416 predicted 1310
7 SASI_Hs02_00324417 predicted 1242
8 SASI_Hs02_00324418 predicted 1720
9 SASI_Hs02_00324419 predicted 412
10 SASI_Hs02_00324420 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331655 predicted 1236
2 SASI_Rn02_00331656 predicted 794
3 SASI_Rn02_00331657 predicted 1015
4 SASI_Rn02_00331658 predicted 286
5 SASI_Rn02_00331659 predicted 863
6 SASI_Rn02_00331660 predicted 811
7 SASI_Rn02_00331661 predicted 1241
8 SASI_Rn02_00331662 predicted 405
9 SASI_Rn02_00331663 predicted 1198
10 SASI_Rn02_00331664 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407741 predicted 1244
2 SASI_Rn02_00407742 predicted 810
3 SASI_Rn02_00407743 predicted 1029
4 SASI_Rn02_00407744 predicted 872
5 SASI_Rn02_00407745 predicted 812
6 SASI_Rn02_00407746 predicted 1248
7 SASI_Rn02_00407747 predicted 1368
8 SASI_Rn02_00407748 predicted 1208
9 SASI_Rn02_00407749 predicted 731
10 SASI_Rn02_00407750 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052037 predicted 699
2 SASI_Mm01_00052038 predicted 1008
3 SASI_Mm01_00052039 predicted 1921
4 SASI_Mm01_00052040 predicted 1335
5 SASI_Mm01_00052041 predicted 1795
6 SASI_Mm01_00052042 predicted 585
7 SASI_Mm01_00052043 predicted 1306
8 SASI_Mm01_00052044 predicted 1645
9 SASI_Mm02_00351545 predicted 565
10 SASI_Mm01_00052045 predicted 1317
11 SASI_Mm01_00052046 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201370
WEE2 MISSION shRNA Bacterial Glycerol Stock
WEE1 homolog 2 (S. pombe)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201370.2-2322s21c1
Sequence:CCGGTACTTTGGCCTATGGATTAAGCTCGAGCTTAATCCATAGGCCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-792s21c1
Sequence:CCGGCTCTTTGTCTCTGGTCAATATCTCGAGATATTGACCAGAGACAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-735s21c1
Sequence:CCGGCTCCCGAAGCTCTAGACATATCTCGAGATATGTCTAGAGCTTCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-1599s21c1
Sequence:CCGGCATATTTGCCTTAGGATTAACCTCGAGGTTAATCCTAAGGCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-782s1c1
Sequence:CCGGCCAGAGACTATCTTGAGGAAACTCGAGTTTCCTCAAGATAGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1546s1c1
Sequence:CCGGGCAGAGTCTTTACCCATCAATCTCGAGATTGATGGGTAAAGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-443s1c1
Sequence:CCGGCCAGAGATGAACTTCATACTTCTCGAGAAGTATGAAGTTCATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1839s1c1
Sequence:CCGGCCACCATTGTTATTATCAGATCTCGAGATCTGATAATAACAATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1174s1c1
Sequence:CCGGGCGTCCAATAATCACTTCCAACTCGAGTTGGAAGTGATTATTGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201370
WEE2 MISSION shRNA shRNA Plasmid DNA
WEE1 homolog 2 (S. pombe)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201370.2-2322s21c1
Sequence:CCGGTACTTTGGCCTATGGATTAAGCTCGAGCTTAATCCATAGGCCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-792s21c1
Sequence:CCGGCTCTTTGTCTCTGGTCAATATCTCGAGATATTGACCAGAGACAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-735s21c1
Sequence:CCGGCTCCCGAAGCTCTAGACATATCTCGAGATATGTCTAGAGCTTCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-1599s21c1
Sequence:CCGGCATATTTGCCTTAGGATTAACCTCGAGGTTAATCCTAAGGCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-782s1c1
Sequence:CCGGCCAGAGACTATCTTGAGGAAACTCGAGTTTCCTCAAGATAGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1546s1c1
Sequence:CCGGGCAGAGTCTTTACCCATCAATCTCGAGATTGATGGGTAAAGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-443s1c1
Sequence:CCGGCCAGAGATGAACTTCATACTTCTCGAGAAGTATGAAGTTCATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1839s1c1
Sequence:CCGGCCACCATTGTTATTATCAGATCTCGAGATCTGATAATAACAATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1174s1c1
Sequence:CCGGGCGTCCAATAATCACTTCCAACTCGAGTTGGAAGTGATTATTGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201370
WEE2 MISSION shRNA Lentiviral Transduction Particles
WEE1 homolog 2 (S. pombe)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201370.2-2322s21c1
Sequence:CCGGTACTTTGGCCTATGGATTAAGCTCGAGCTTAATCCATAGGCCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-792s21c1
Sequence:CCGGCTCTTTGTCTCTGGTCAATATCTCGAGATATTGACCAGAGACAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-735s21c1
Sequence:CCGGCTCCCGAAGCTCTAGACATATCTCGAGATATGTCTAGAGCTTCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201370.2-1599s21c1
Sequence:CCGGCATATTTGCCTTAGGATTAACCTCGAGGTTAATCCTAAGGCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-782s1c1
Sequence:CCGGCCAGAGACTATCTTGAGGAAACTCGAGTTTCCTCAAGATAGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1546s1c1
Sequence:CCGGGCAGAGTCTTTACCCATCAATCTCGAGATTGATGGGTAAAGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-443s1c1
Sequence:CCGGCCAGAGATGAACTTCATACTTCTCGAGAAGTATGAAGTTCATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1839s1c1
Sequence:CCGGCCACCATTGTTATTATCAGATCTCGAGATCTGATAATAACAATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201370.1-1174s1c1
Sequence:CCGGGCGTCCAATAATCACTTCCAACTCGAGTTGGAAGTGATTATTGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105558
WEE2 MISSION shRNA Bacterial Glycerol Stock
WEE1 homolog 2 (S. pombe)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-850s21c1
Sequence:CCGGCTCATTGGCTCTGGTCAATATCTCGAGATATTGACCAGAGCCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-1318s21c1
Sequence:CCGGCACTAAGTCTGGCAATCATTTCTCGAGAAATGATTGCCAGACTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105558.1-2271s21c1
Sequence:CCGGCAGCGCTTCCCAGGTTATATGCTCGAGCATATAACCTGGGAAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-1215s21c1
Sequence:CCGGCCCATGTGGTACGTTACTATTCTCGAGAATAGTAACGTACCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-878s21c1
Sequence:CCGGTTCACTCCAGAGTCCTATAAACTCGAGTTTATAGGACTCTGGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105558
WEE2 MISSION shRNA shRNA Plasmid DNA
WEE1 homolog 2 (S. pombe)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-850s21c1
Sequence:CCGGCTCATTGGCTCTGGTCAATATCTCGAGATATTGACCAGAGCCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-1318s21c1
Sequence:CCGGCACTAAGTCTGGCAATCATTTCTCGAGAAATGATTGCCAGACTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105558.1-2271s21c1
Sequence:CCGGCAGCGCTTCCCAGGTTATATGCTCGAGCATATAACCTGGGAAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-1215s21c1
Sequence:CCGGCCCATGTGGTACGTTACTATTCTCGAGAATAGTAACGTACCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-878s21c1
Sequence:CCGGTTCACTCCAGAGTCCTATAAACTCGAGTTTATAGGACTCTGGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105558
WEE2 MISSION shRNA Lentiviral Transduction Particles
WEE1 homolog 2 (S. pombe)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-850s21c1
Sequence:CCGGCTCATTGGCTCTGGTCAATATCTCGAGATATTGACCAGAGCCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-1318s21c1
Sequence:CCGGCACTAAGTCTGGCAATCATTTCTCGAGAAATGATTGCCAGACTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105558.1-2271s21c1
Sequence:CCGGCAGCGCTTCCCAGGTTATATGCTCGAGCATATAACCTGGGAAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-1215s21c1
Sequence:CCGGCCCATGTGGTACGTTACTATTCTCGAGAATAGTAACGTACCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105558.1-878s21c1
Sequence:CCGGTTCACTCCAGAGTCCTATAAACTCGAGTTTATAGGACTCTGGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks