EMAIL THIS PAGE TO A FRIEND

WFDC10A

WAP four-disulfide core domain 10A

Synonyms: C20orf146 WAP10 dJ688G8.3
UniProtKB ID: Q9H1F0, A2RRE9, Q5TGZ7
Gene ID:
Human(140832) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. [provided by RefSeq, Jul 2008]
Rat(296363) WAP four-disulfide core domain 10A
cow(100296236) WAP four-disulfide core domain 10A
domestic guinea pig(100726276) WAP four-disulfide core domain 10A
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080753 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080753 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180767 predicted 235
2 SASI_Hs01_00180768 predicted 191
3 SASI_Hs01_00180769 predicted 228
4 SASI_Hs01_00180770 predicted 238
5 SASI_Hs01_00180771 predicted 250
6 SASI_Hs01_00180772 predicted 204
7 SASI_Hs01_00180773 predicted 203
8 SASI_Hs01_00180774 predicted 223
9 SASI_Hs01_00180775 predicted 236
10 SASI_Hs01_00180776 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080753
WFDC10A MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 10A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080753.2-213s21c1
Sequence:CCGGCTATGCAAACACTTATGTGAACTCGAGTTCACATAAGTGTTTGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080753.2-131s21c1
Sequence:CCGGAGGATACCGTGACAAGAAGAGCTCGAGCTCTTCTTGTCACGGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-238s1c2
Sequence:CCGGACCGAGATTGTCAAGCAAATACTCGAGTATTTGCTTGACAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-281s1c2
Sequence:CCGGTGGGAATGTTTGCATGAGCATCTCGAGATGCTCATGCAAACATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-236s1c1
Sequence:CCGGTCACCGAGATTGTCAAGCAAACTCGAGTTTGCTTGACAATCTCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-200s1c1
Sequence:CCGGGCCTAAACTATATCTATGCAACTCGAGTTGCATAGATATAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-271s1c1
Sequence:CCGGCTACCTACTGTGGGAATGTTTCTCGAGAAACATTCCCACAGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080753
WFDC10A MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 10A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080753.2-213s21c1
Sequence:CCGGCTATGCAAACACTTATGTGAACTCGAGTTCACATAAGTGTTTGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080753.2-131s21c1
Sequence:CCGGAGGATACCGTGACAAGAAGAGCTCGAGCTCTTCTTGTCACGGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-238s1c2
Sequence:CCGGACCGAGATTGTCAAGCAAATACTCGAGTATTTGCTTGACAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-281s1c2
Sequence:CCGGTGGGAATGTTTGCATGAGCATCTCGAGATGCTCATGCAAACATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-236s1c1
Sequence:CCGGTCACCGAGATTGTCAAGCAAACTCGAGTTTGCTTGACAATCTCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-200s1c1
Sequence:CCGGGCCTAAACTATATCTATGCAACTCGAGTTGCATAGATATAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-271s1c1
Sequence:CCGGCTACCTACTGTGGGAATGTTTCTCGAGAAACATTCCCACAGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080753
WFDC10A MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 10A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080753.2-213s21c1
Sequence:CCGGCTATGCAAACACTTATGTGAACTCGAGTTCACATAAGTGTTTGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080753.2-131s21c1
Sequence:CCGGAGGATACCGTGACAAGAAGAGCTCGAGCTCTTCTTGTCACGGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-238s1c2
Sequence:CCGGACCGAGATTGTCAAGCAAATACTCGAGTATTTGCTTGACAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-281s1c2
Sequence:CCGGTGGGAATGTTTGCATGAGCATCTCGAGATGCTCATGCAAACATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-236s1c1
Sequence:CCGGTCACCGAGATTGTCAAGCAAACTCGAGTTTGCTTGACAATCTCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-200s1c1
Sequence:CCGGGCCTAAACTATATCTATGCAACTCGAGTTGCATAGATATAGTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080753.2-271s1c1
Sequence:CCGGCTACCTACTGTGGGAATGTTTCTCGAGAAACATTCCCACAGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks