EMAIL THIS PAGE TO A FRIEND

WFDC10B

WAP four-disulfide core domain 10B

Synonyms: WAP12
UniProtKB ID: Q8IUB3, A6PVD7, Q0VAG0, Q0VAG1, Q5TGZ5, Q8IUB4
Gene ID:
Human(280664) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode distinct isoforms. [provided by RefSeq, Jul 2008]
dog(100685937) WAP four-disulfide core domain 10B
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172006 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079101 MISSION® esiRNA esiRNA human WFDC10B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172006 Rosetta Predictions human pricing
NM_172131 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121146 predicted 353
2 SASI_Hs01_00121147 predicted 341
3 SASI_Hs01_00121149 predicted 356
4 SASI_Hs01_00121150 predicted 359
5 SASI_Hs01_00121151 predicted 404
6 SASI_Hs01_00121152 predicted 333
7 SASI_Hs01_00121153 predicted 312
8 SASI_Hs01_00121154 predicted 341
9 SASI_Hs01_00121155 predicted 328
10 SASI_Hs02_00367773 predicted 335
11 SASI_Hs01_00121148 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154904 predicted 205
2 SASI_Hs01_00154906 predicted 201
3 SASI_Hs01_00154907 predicted 205
4 SASI_Hs01_00154908 predicted 246
5 SASI_Hs01_00154909 predicted 206
6 SASI_Hs01_00154910 predicted 251
7 SASI_Hs01_00154911 predicted 249
8 SASI_Hs01_00154912 predicted 248
9 SASI_Hs01_00154905 predicted 211
10 SASI_Hs02_00367849 predicted 236
11 SASI_Hs01_00154913 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172006
WFDC10B MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 10B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-368s1c1
Sequence:CCGGACCACTGTTCATATTTCCAAACTCGAGTTTGGAAATATGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-429s1c1
Sequence:CCGGGAACATTTGTATGAGCATCCTCTCGAGAGGATGCTCATACAAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-345s1c1
Sequence:CCGGACCCAGCATAGATCTATGCATCTCGAGATGCATAGATCTATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-404s1c1
Sequence:CCGGAGATATGCTGTTCAGCCTTCTCTCGAGAGAAGGCTGAACAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-361s1c1
Sequence:CCGGTGCATCCACCACTGTTCATATCTCGAGATATGAACAGTGGTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172006.2-337s21c1
Sequence:CCGGGAGAAGCGACCCAGCATAGATCTCGAGATCTATGCTGGGTCGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172006.2-353s21c1
Sequence:CCGGTAGATCTATGCATCCACCACTCTCGAGAGTGGTGGATGCATAGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172006
WFDC10B MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 10B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-368s1c1
Sequence:CCGGACCACTGTTCATATTTCCAAACTCGAGTTTGGAAATATGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-429s1c1
Sequence:CCGGGAACATTTGTATGAGCATCCTCTCGAGAGGATGCTCATACAAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-345s1c1
Sequence:CCGGACCCAGCATAGATCTATGCATCTCGAGATGCATAGATCTATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-404s1c1
Sequence:CCGGAGATATGCTGTTCAGCCTTCTCTCGAGAGAAGGCTGAACAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-361s1c1
Sequence:CCGGTGCATCCACCACTGTTCATATCTCGAGATATGAACAGTGGTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172006.2-337s21c1
Sequence:CCGGGAGAAGCGACCCAGCATAGATCTCGAGATCTATGCTGGGTCGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172006.2-353s21c1
Sequence:CCGGTAGATCTATGCATCCACCACTCTCGAGAGTGGTGGATGCATAGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172006
WFDC10B MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 10B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-368s1c1
Sequence:CCGGACCACTGTTCATATTTCCAAACTCGAGTTTGGAAATATGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-429s1c1
Sequence:CCGGGAACATTTGTATGAGCATCCTCTCGAGAGGATGCTCATACAAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-345s1c1
Sequence:CCGGACCCAGCATAGATCTATGCATCTCGAGATGCATAGATCTATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-404s1c1
Sequence:CCGGAGATATGCTGTTCAGCCTTCTCTCGAGAGAAGGCTGAACAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172006.2-361s1c1
Sequence:CCGGTGCATCCACCACTGTTCATATCTCGAGATATGAACAGTGGTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172006.2-337s21c1
Sequence:CCGGGAGAAGCGACCCAGCATAGATCTCGAGATCTATGCTGGGTCGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172006.2-353s21c1
Sequence:CCGGTAGATCTATGCATCCACCACTCTCGAGAGTGGTGGATGCATAGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks