EMAIL THIS PAGE TO A FRIEND

WFDC11

WAP four-disulfide core domain 11

Synonyms: WAP11
UniProtKB ID: Q8NEX6, E1P624, Q5TGZ6
Gene ID:
Human(259239) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. [provided by RefSeq, Jul 2008]
Mouse(629761) WAP four-disulfide core domain 11
Rat(685227) WAP four-disulfide core domain 11
cow(767987) WAP four-disulfide core domain 11
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147197 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001161806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001161806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001161806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130101 MISSION® esiRNA esiRNA human WFDC11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147197 Rosetta Predictions human pricing
XM_001062897 Rosetta Predictions rat pricing
XM_001477558 Rosetta Predictions mouse pricing
XM_001481196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016516 predicted 288
2 SASI_Hs02_00365539 predicted 327
3 SASI_Hs01_00016518 predicted 288
4 SASI_Hs01_00016519 predicted 339
5 SASI_Hs01_00016520 predicted 341
6 SASI_Hs01_00016521 predicted 355
7 SASI_Hs01_00016522 predicted 349
8 SASI_Hs01_00016523 predicted 342
9 SASI_Hs01_00016524 predicted 359
10 SASI_Hs01_00016525 predicted 355
11 SASI_Hs01_00016517 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305000 predicted 242
2 SASI_Rn02_00305001 predicted 261
3 SASI_Rn02_00305002 predicted 164
4 SASI_Rn02_00305003 predicted 67
5 SASI_Rn02_00305004 predicted 62
6 SASI_Rn02_00305005 predicted 309
7 SASI_Rn02_00305006 predicted 257
8 SASI_Rn02_00305007 predicted 239
9 SASI_Rn02_00305008 predicted 69
10 SASI_Rn02_00305009 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00396670 predicted 286
2 SASI_Mm02_00396671 predicted 373
3 SASI_Mm02_00396672 predicted 234
4 SASI_Mm02_00396673 predicted 352
5 SASI_Mm02_00396674 predicted 354
6 SASI_Mm02_00396675 predicted 366
7 SASI_Mm02_00396676 predicted 231
8 SASI_Mm02_00396677 predicted 281
9 SASI_Mm02_00396678 predicted 358
10 SASI_Mm02_00396679 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00422742 predicted 281
2 SASI_Mm02_00422743 predicted 376
3 SASI_Mm02_00422744 predicted 239
4 SASI_Mm02_00422745 predicted 353
5 SASI_Mm02_00422746 predicted 358
6 SASI_Mm02_00422747 predicted 368
7 SASI_Mm02_00422748 predicted 229
8 SASI_Mm02_00422749 predicted 286
9 SASI_Mm02_00422750 predicted 359
10 SASI_Mm02_00422751 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147197
WFDC11 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-255s21c1
Sequence:CCGGACTGTCTGTGCTGGGAGAAATCTCGAGATTTCTCCCAGCACAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-435s1c2
Sequence:CCGGCGTCGAAACCAGTGGAGATTACTCGAGTAATCTCCACTGGTTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-390s21c1
Sequence:CCGGTTACACATGCTGCTGGACCTACTCGAGTAGGTCCAGCAGCATGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-351s21c1
Sequence:CCGGCAATAAGTGTTCTAAAGCCTTCTCGAGAAGGCTTTAGAACACTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-326s1c1
Sequence:CCGGGAAAGCCAAATGTCAAAGAATCTCGAGATTCTTTGACATTTGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-231s1c1
Sequence:CCGGCATGACATTCTTCTGTACGGTCTCGAGACCGTACAGAAGAATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-292s1c1
Sequence:CCGGGACAGGAAGGAATTGTTACTTCTCGAGAAGTAACAATTCCTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-413s1c1
Sequence:CCGGGTGGAAACATCTGCTGGATAACTCGAGTTATCCAGCAGATGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147197
WFDC11 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-255s21c1
Sequence:CCGGACTGTCTGTGCTGGGAGAAATCTCGAGATTTCTCCCAGCACAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-435s1c2
Sequence:CCGGCGTCGAAACCAGTGGAGATTACTCGAGTAATCTCCACTGGTTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-390s21c1
Sequence:CCGGTTACACATGCTGCTGGACCTACTCGAGTAGGTCCAGCAGCATGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-351s21c1
Sequence:CCGGCAATAAGTGTTCTAAAGCCTTCTCGAGAAGGCTTTAGAACACTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-326s1c1
Sequence:CCGGGAAAGCCAAATGTCAAAGAATCTCGAGATTCTTTGACATTTGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-231s1c1
Sequence:CCGGCATGACATTCTTCTGTACGGTCTCGAGACCGTACAGAAGAATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-292s1c1
Sequence:CCGGGACAGGAAGGAATTGTTACTTCTCGAGAAGTAACAATTCCTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-413s1c1
Sequence:CCGGGTGGAAACATCTGCTGGATAACTCGAGTTATCCAGCAGATGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147197
WFDC11 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-255s21c1
Sequence:CCGGACTGTCTGTGCTGGGAGAAATCTCGAGATTTCTCCCAGCACAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-435s1c2
Sequence:CCGGCGTCGAAACCAGTGGAGATTACTCGAGTAATCTCCACTGGTTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-390s21c1
Sequence:CCGGTTACACATGCTGCTGGACCTACTCGAGTAGGTCCAGCAGCATGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147197.2-351s21c1
Sequence:CCGGCAATAAGTGTTCTAAAGCCTTCTCGAGAAGGCTTTAGAACACTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-326s1c1
Sequence:CCGGGAAAGCCAAATGTCAAAGAATCTCGAGATTCTTTGACATTTGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-231s1c1
Sequence:CCGGCATGACATTCTTCTGTACGGTCTCGAGACCGTACAGAAGAATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-292s1c1
Sequence:CCGGGACAGGAAGGAATTGTTACTTCTCGAGAAGTAACAATTCCTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147197.2-413s1c1
Sequence:CCGGGTGGAAACATCTGCTGGATAACTCGAGTTATCCAGCAGATGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001161806
WFDC11 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-288s21c1
Sequence:CCGGAGGGAGGAAGAACAAGTATTACTCGAGTAATACTTGTTCTTCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-305s21c1
Sequence:CCGGATTATCCTGGAGAACTATTACCTCGAGGTAATAGTTCTCCAGGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-360s21c1
Sequence:CCGGCTGCGTCAAGAAGTGTTCTAGCTCGAGCTAGAACACTTCTTGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-371s21c1
Sequence:CCGGAGTGTTCTAGAACTTTCAAATCTCGAGATTTGAAAGTTCTAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-392s21c1
Sequence:CCGGGTGTATACAGAAACCACACATCTCGAGATGTGTGGTTTCTGTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001161806
WFDC11 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-288s21c1
Sequence:CCGGAGGGAGGAAGAACAAGTATTACTCGAGTAATACTTGTTCTTCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-305s21c1
Sequence:CCGGATTATCCTGGAGAACTATTACCTCGAGGTAATAGTTCTCCAGGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-360s21c1
Sequence:CCGGCTGCGTCAAGAAGTGTTCTAGCTCGAGCTAGAACACTTCTTGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-371s21c1
Sequence:CCGGAGTGTTCTAGAACTTTCAAATCTCGAGATTTGAAAGTTCTAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-392s21c1
Sequence:CCGGGTGTATACAGAAACCACACATCTCGAGATGTGTGGTTTCTGTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001161806
WFDC11 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-288s21c1
Sequence:CCGGAGGGAGGAAGAACAAGTATTACTCGAGTAATACTTGTTCTTCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-305s21c1
Sequence:CCGGATTATCCTGGAGAACTATTACCTCGAGGTAATAGTTCTCCAGGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-360s21c1
Sequence:CCGGCTGCGTCAAGAAGTGTTCTAGCTCGAGCTAGAACACTTCTTGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-371s21c1
Sequence:CCGGAGTGTTCTAGAACTTTCAAATCTCGAGATTTGAAAGTTCTAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161806.1-392s21c1
Sequence:CCGGGTGTATACAGAAACCACACATCTCGAGATGTGTGGTTTCTGTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks