EMAIL THIS PAGE TO A FRIEND

WFDC12

WAP four-disulfide core domain 12

Synonyms: C20orf122 SWAM2 WAP2 dJ211D12.4
UniProtKB ID: Q8WWY7, Q5H980, Q9BR31
Gene ID:
Human(128488) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the centromeric cluster. [provided by RefSeq, Jul 2008]
Mouse(192200) WAP four-disulfide core domain 12
Rat(408227) WAP four-disulfide core domain 12
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301115 ANTI-WFDC12 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080869 Rosetta Predictions human pricing
NM_001008866 Rosetta Predictions rat pricing
NM_138684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208223 predicted 224
2 SASI_Hs01_00208224 predicted 324
3 SASI_Hs01_00208225 predicted 208
4 SASI_Hs01_00208226 predicted 313
5 SASI_Hs01_00208227 predicted 269
6 SASI_Hs01_00208228 predicted 283
7 SASI_Hs01_00208229 predicted 255
8 SASI_Hs01_00208230 predicted 206
9 SASI_Hs01_00208231 predicted 332
10 SASI_Hs01_00208232 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199393 predicted 145
2 SASI_Rn01_00099613 predicted 96
3 SASI_Rn01_00099614 predicted 181
4 SASI_Rn01_00099615 predicted 85
5 SASI_Rn01_00099616 predicted 32
6 SASI_Rn01_00099617 predicted 79
7 SASI_Rn01_00099618 predicted 19
8 SASI_Rn01_00099619 predicted 27
9 SASI_Rn01_00099620 predicted 60
10 SASI_Rn01_00099621 predicted 162
11 SASI_Rn01_00099622 predicted 37
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186205 predicted 285
2 SASI_Mm01_00186206 predicted 284
3 SASI_Mm01_00186207 predicted 278
4 SASI_Mm01_00186208 predicted 276
5 SASI_Mm01_00186209 predicted 265
6 SASI_Mm01_00186210 predicted 272
7 SASI_Mm01_00186212 predicted 262
8 SASI_Mm01_00186213 predicted 202
9 SASI_Mm02_00339771 predicted 287
10 SASI_Mm01_00186214 predicted 204
11 SASI_Mm01_00186211 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080869
WFDC12 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080869.1-412s1c1
Sequence:CCGGCCTGAGACTTGGAATATGGAACTCGAGTTCCATATTCCAAGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-82s1c1
Sequence:CCGGGAAGGAGTTAAAGAGGGTATACTCGAGTATACCCTCTTTAACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-263s1c1
Sequence:CCGGACAAGGATGAAGATGTGTCAACTCGAGTTGACACATCTTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-332s1c1
Sequence:CCGGCTACCAGGTGTCCTCAGAAATCTCGAGATTTCTGAGGACACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-214s1c1
Sequence:CCGGTGTGGCTTCAAGTGTGTGATTCTCGAGAATCACACACTTGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080869.1-523s21c1
Sequence:CCGGGGACGGTACTTTCCCTCTCTACTCGAGTAGAGAGGGAAAGTACCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080869.1-129s21c1
Sequence:CCGGCAACGTACGCTGCTTCAAGTCCTCGAGGACTTGAAGCAGCGTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080869
WFDC12 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080869.1-412s1c1
Sequence:CCGGCCTGAGACTTGGAATATGGAACTCGAGTTCCATATTCCAAGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-82s1c1
Sequence:CCGGGAAGGAGTTAAAGAGGGTATACTCGAGTATACCCTCTTTAACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-263s1c1
Sequence:CCGGACAAGGATGAAGATGTGTCAACTCGAGTTGACACATCTTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-332s1c1
Sequence:CCGGCTACCAGGTGTCCTCAGAAATCTCGAGATTTCTGAGGACACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-214s1c1
Sequence:CCGGTGTGGCTTCAAGTGTGTGATTCTCGAGAATCACACACTTGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080869.1-523s21c1
Sequence:CCGGGGACGGTACTTTCCCTCTCTACTCGAGTAGAGAGGGAAAGTACCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080869.1-129s21c1
Sequence:CCGGCAACGTACGCTGCTTCAAGTCCTCGAGGACTTGAAGCAGCGTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080869
WFDC12 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080869.1-412s1c1
Sequence:CCGGCCTGAGACTTGGAATATGGAACTCGAGTTCCATATTCCAAGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-82s1c1
Sequence:CCGGGAAGGAGTTAAAGAGGGTATACTCGAGTATACCCTCTTTAACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-263s1c1
Sequence:CCGGACAAGGATGAAGATGTGTCAACTCGAGTTGACACATCTTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-332s1c1
Sequence:CCGGCTACCAGGTGTCCTCAGAAATCTCGAGATTTCTGAGGACACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080869.1-214s1c1
Sequence:CCGGTGTGGCTTCAAGTGTGTGATTCTCGAGAATCACACACTTGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080869.1-523s21c1
Sequence:CCGGGGACGGTACTTTCCCTCTCTACTCGAGTAGAGAGGGAAAGTACCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080869.1-129s21c1
Sequence:CCGGCAACGTACGCTGCTTCAAGTCCTCGAGGACTTGAAGCAGCGTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138684
WFDC12 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138684.2-425s1c1
Sequence:CCGGCCTCCAGAACTCTGAGAAATACTCGAGTATTTCTCAGAGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-250s1c1
Sequence:CCGGCCGGTGAAAGACAACAGTGAACTCGAGTTCACTGTTGTCTTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-72s1c1
Sequence:CCGGGCTCCTTATTTCCTCTACTCTCTCGAGAGAGTAGAGGAAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-221s1c1
Sequence:CCGGTCTGGCAATGTGGCTTCAAATCTCGAGATTTGAAGCCACATTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-270s1c1
Sequence:CCGGAGAACAGATCCCTCAGAGTAACTCGAGTTACTCTGAGGGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138684
WFDC12 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138684.2-425s1c1
Sequence:CCGGCCTCCAGAACTCTGAGAAATACTCGAGTATTTCTCAGAGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-250s1c1
Sequence:CCGGCCGGTGAAAGACAACAGTGAACTCGAGTTCACTGTTGTCTTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-72s1c1
Sequence:CCGGGCTCCTTATTTCCTCTACTCTCTCGAGAGAGTAGAGGAAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-221s1c1
Sequence:CCGGTCTGGCAATGTGGCTTCAAATCTCGAGATTTGAAGCCACATTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-270s1c1
Sequence:CCGGAGAACAGATCCCTCAGAGTAACTCGAGTTACTCTGAGGGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138684
WFDC12 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138684.2-425s1c1
Sequence:CCGGCCTCCAGAACTCTGAGAAATACTCGAGTATTTCTCAGAGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-250s1c1
Sequence:CCGGCCGGTGAAAGACAACAGTGAACTCGAGTTCACTGTTGTCTTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-72s1c1
Sequence:CCGGGCTCCTTATTTCCTCTACTCTCTCGAGAGAGTAGAGGAAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-221s1c1
Sequence:CCGGTCTGGCAATGTGGCTTCAAATCTCGAGATTTGAAGCCACATTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138684.2-270s1c1
Sequence:CCGGAGAACAGATCCCTCAGAGTAACTCGAGTTACTCTGAGGGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks