EMAIL THIS PAGE TO A FRIEND

WFDC13

WAP four-disulfide core domain 13

Synonyms: C20orf138 WAP13 dJ601O1.3
UniProtKB ID: Q8IUB5, Q5TEU7, Q8WWK7
Gene ID:
Human(164237) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. [provided by RefSeq, Jul 2008]
Mouse(408190) WAP four-disulfide core domain 13
domestic cat(101086892) WAP four-disulfide core domain 13
domestic guinea pig(100726548) WAP four-disulfide core domain 13
cow(101907910) WAP four-disulfide core domain 13
sheep(101112081) WAP four-disulfide core domain 13
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172005 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172005 Rosetta Predictions human pricing
NM_001012704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148725 predicted 209
2 SASI_Hs01_00148726 predicted 805
3 SASI_Hs01_00148727 predicted 212
4 SASI_Hs01_00148728 predicted 208
5 SASI_Hs01_00148730 predicted 233
6 SASI_Hs01_00148731 predicted 807
7 SASI_Hs01_00148732 predicted 801
8 SASI_Hs01_00148733 predicted 233
9 SASI_Hs01_00148734 predicted 199
10 SASI_Hs02_00367772 predicted 231
11 SASI_Hs01_00148729 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120827 predicted 411
2 SASI_Mm01_00120828 predicted 465
3 SASI_Mm01_00120829 predicted 293
4 SASI_Mm01_00120830 predicted 265
5 SASI_Mm01_00120831 predicted 335
6 SASI_Mm01_00120832 predicted 308
7 SASI_Mm01_00120833 predicted 303
8 SASI_Mm01_00120834 predicted 288
9 SASI_Mm01_00120835 predicted 241
10 SASI_Mm01_00120836 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172005
WFDC13 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172005.1-514s21c1
Sequence:CCGGATAAAGGCTAATCTACCATAACTCGAGTTATGGTAGATTAGCCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172005.1-268s21c1
Sequence:CCCGGATTGCGAGAAAGGATTTCAGCTCGAGCTGAAATCCTTTCTCGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172005.1-272s1c1
Sequence:CCGGGCGAGAAAGGATTTCAGTGCTCTCGAGAGCACTGAAATCCTTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-347s1c1
Sequence:CCGGGAATCAAACACAAGGGCTCAGCTCGAGCTGAGCCCTTGTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-240s1c1
Sequence:CCGGCTGTACTCACCTGTGTACAATCTCGAGATTGTACACAGGTGAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-193s1c1
Sequence:CCGGCTGAAGTATATCTTGGAACCTCTCGAGAGGTTCCAAGATATACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172005.1-1140s1c1
Sequence:CCGGCCTTCTGTTCTCTCTACAGAACTCGAGTTCTGTAGAGAGAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-309s1c1
Sequence:CCGGGATAGTCTGTTCATCAGAAACCTCGAGGTTTCTGATGAACAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172005.1-476s1c1
Sequence:CCGGCCCAATATCTAACCTGCAAATCTCGAGATTTGCAGGTTAGATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172005.1-339s1c1
Sequence:CCGGGCGCAACAGAATCAAACACAACTCGAGTTGTGTTTGATTCTGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172005
WFDC13 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172005.1-514s21c1
Sequence:CCGGATAAAGGCTAATCTACCATAACTCGAGTTATGGTAGATTAGCCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172005.1-268s21c1
Sequence:CCCGGATTGCGAGAAAGGATTTCAGCTCGAGCTGAAATCCTTTCTCGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172005.1-272s1c1
Sequence:CCGGGCGAGAAAGGATTTCAGTGCTCTCGAGAGCACTGAAATCCTTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-347s1c1
Sequence:CCGGGAATCAAACACAAGGGCTCAGCTCGAGCTGAGCCCTTGTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-240s1c1
Sequence:CCGGCTGTACTCACCTGTGTACAATCTCGAGATTGTACACAGGTGAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-193s1c1
Sequence:CCGGCTGAAGTATATCTTGGAACCTCTCGAGAGGTTCCAAGATATACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172005.1-1140s1c1
Sequence:CCGGCCTTCTGTTCTCTCTACAGAACTCGAGTTCTGTAGAGAGAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-309s1c1
Sequence:CCGGGATAGTCTGTTCATCAGAAACCTCGAGGTTTCTGATGAACAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172005.1-476s1c1
Sequence:CCGGCCCAATATCTAACCTGCAAATCTCGAGATTTGCAGGTTAGATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172005.1-339s1c1
Sequence:CCGGGCGCAACAGAATCAAACACAACTCGAGTTGTGTTTGATTCTGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172005
WFDC13 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172005.1-514s21c1
Sequence:CCGGATAAAGGCTAATCTACCATAACTCGAGTTATGGTAGATTAGCCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172005.1-268s21c1
Sequence:CCCGGATTGCGAGAAAGGATTTCAGCTCGAGCTGAAATCCTTTCTCGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172005.1-272s1c1
Sequence:CCGGGCGAGAAAGGATTTCAGTGCTCTCGAGAGCACTGAAATCCTTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-347s1c1
Sequence:CCGGGAATCAAACACAAGGGCTCAGCTCGAGCTGAGCCCTTGTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-240s1c1
Sequence:CCGGCTGTACTCACCTGTGTACAATCTCGAGATTGTACACAGGTGAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-193s1c1
Sequence:CCGGCTGAAGTATATCTTGGAACCTCTCGAGAGGTTCCAAGATATACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172005.1-1140s1c1
Sequence:CCGGCCTTCTGTTCTCTCTACAGAACTCGAGTTCTGTAGAGAGAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172005.1-309s1c1
Sequence:CCGGGATAGTCTGTTCATCAGAAACCTCGAGGTTTCTGATGAACAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172005.1-476s1c1
Sequence:CCGGCCCAATATCTAACCTGCAAATCTCGAGATTTGCAGGTTAGATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172005.1-339s1c1
Sequence:CCGGGCGCAACAGAATCAAACACAACTCGAGTTGTGTTTGATTCTGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012704
WFDC13 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-172s1c1
Sequence:CCGGGCTTGGAAGTCCCAAGCAATACTCGAGTATTGCTTGGGACTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012704.1-480s1c1
Sequence:CCGGGCCATCCTTGTCTCTCTCTTTCTCGAGAAAGAGAGAGACAAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012704.1-240s1c1
Sequence:CCGGGAGCGTGCAACATGTTCTGTACTCGAGTACAGAACATGTTGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012704.1-184s1c1
Sequence:CCGGCAAGCAATACTTTCTGAAGTACTCGAGTACTTCAGAAAGTATTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012704.1-696s1c1
Sequence:CCGGGCATGTCTGTTGCCTTTAATACTCGAGTATTAAAGGCAACAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-197s1c1
Sequence:CCGGCTGAAGTACATCCTGGAACCTCTCGAGAGGTTCCAGGATGTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-247s1c1
Sequence:CCGGCAACATGTTCTGTACGCAGCACTCGAGTGCTGCGTACAGAACATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012704
WFDC13 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-172s1c1
Sequence:CCGGGCTTGGAAGTCCCAAGCAATACTCGAGTATTGCTTGGGACTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012704.1-480s1c1
Sequence:CCGGGCCATCCTTGTCTCTCTCTTTCTCGAGAAAGAGAGAGACAAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012704.1-240s1c1
Sequence:CCGGGAGCGTGCAACATGTTCTGTACTCGAGTACAGAACATGTTGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012704.1-184s1c1
Sequence:CCGGCAAGCAATACTTTCTGAAGTACTCGAGTACTTCAGAAAGTATTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012704.1-696s1c1
Sequence:CCGGGCATGTCTGTTGCCTTTAATACTCGAGTATTAAAGGCAACAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-197s1c1
Sequence:CCGGCTGAAGTACATCCTGGAACCTCTCGAGAGGTTCCAGGATGTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-247s1c1
Sequence:CCGGCAACATGTTCTGTACGCAGCACTCGAGTGCTGCGTACAGAACATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012704
WFDC13 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-172s1c1
Sequence:CCGGGCTTGGAAGTCCCAAGCAATACTCGAGTATTGCTTGGGACTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012704.1-480s1c1
Sequence:CCGGGCCATCCTTGTCTCTCTCTTTCTCGAGAAAGAGAGAGACAAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012704.1-240s1c1
Sequence:CCGGGAGCGTGCAACATGTTCTGTACTCGAGTACAGAACATGTTGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012704.1-184s1c1
Sequence:CCGGCAAGCAATACTTTCTGAAGTACTCGAGTACTTCAGAAAGTATTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012704.1-696s1c1
Sequence:CCGGGCATGTCTGTTGCCTTTAATACTCGAGTATTAAAGGCAACAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-197s1c1
Sequence:CCGGCTGAAGTACATCCTGGAACCTCTCGAGAGGTTCCAGGATGTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012704.1-247s1c1
Sequence:CCGGCAACATGTTCTGTACGCAGCACTCGAGTGCTGCGTACAGAACATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks