EMAIL THIS PAGE TO A FRIEND

WFDC1

WAP four-disulfide core domain 1

Synonyms: PS20
UniProtKB ID: Q9HC57, D3DUL7, Q8NC27, Q9HAU1
Gene ID:
Human(58189) Summary: This gene encodes a member of the WAP-type four disulfide core domain family. The WAP-type four-disulfide core domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. The encoded protein shares 81% amino acid identity with the rat ps20 protein, which was originally identified as a secreted growth inhibitor. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor. Owing to its location and a possible growth inhibitory property of its gene product, this gene is suggested to be a tumor suppressor gene. [provided by RefSeq, Jul 2008]
Mouse(67866) WAP four-disulfide core domain 1
Rat(171112) WAP four-disulfide core domain 1
cow(505366) WAP four-disulfide core domain 1
sheep(101102920) WAP four-disulfide core domain 1
domestic guinea pig(100727072) WAP four-disulfide core domain 1
naked mole-rat(101710653) WAP four-disulfide core domain 1
Zebrafish(560860) WAP four-disulfide core domain 1
domestic cat(101088637) WAP four-disulfide core domain 1
dog(489682) WAP four-disulfide core domain 1
chicken(395238) WAP four-disulfide core domain 1
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021197 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021197 Rosetta Predictions human pricing
NM_133581 Rosetta Predictions rat pricing
NM_023395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137784 predicted 640
2 SASI_Hs01_00137785 predicted 577
3 SASI_Hs01_00137786 predicted 673
4 SASI_Hs01_00137787 predicted 673
5 SASI_Hs01_00137788 predicted 596
6 SASI_Hs01_00137789 predicted 569
7 SASI_Hs01_00137790 predicted 567
8 SASI_Hs01_00137791 predicted 667
9 SASI_Hs01_00137793 predicted 736
10 SASI_Hs02_00354781 predicted 221
11 SASI_Hs01_00137792 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053387 predicted 299
2 SASI_Rn01_00053388 predicted 759
3 SASI_Rn02_00267780 predicted 291
4 SASI_Rn01_00053389 predicted 273
5 SASI_Rn01_00053390 predicted 561
6 SASI_Rn01_00053391 predicted 612
7 SASI_Rn01_00053392 predicted 602
8 SASI_Rn01_00053393 predicted 766
9 SASI_Rn01_00053395 predicted 621
10 SASI_Rn01_00053396 predicted 541
11 SASI_Rn01_00053394 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020588 predicted 796
2 SASI_Mm01_00020591 predicted 882
3 SASI_Mm01_00020592 predicted 671
4 SASI_Mm02_00327090 predicted 273
5 SASI_Mm01_00020595 predicted 867
6 SASI_Mm02_00327091 predicted 664
7 SASI_Mm02_00327092 predicted 837
8 SASI_Mm02_00327093 predicted 549
9 SASI_Mm02_00327094 predicted 874
10 SASI_Mm02_00327095 predicted 620
11 SASI_Mm01_00020586 predicted 731
12 SASI_Mm01_00020587 predicted 898
13 SASI_Mm01_00020589 predicted 204
14 SASI_Mm01_00020590 predicted 744
15 SASI_Mm01_00020593 predicted 790
16 SASI_Mm01_00020594 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023395
WFDC1 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023395.1-753s1c1
Sequence:CCGGCCTTGGAAACAGCCAAAGAATCTCGAGATTCTTTGGCTGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-76s1c1
Sequence:CCGGGCTCTGAGTTTCCTGTTGCTACTCGAGTAGCAACAGGAAACTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-488s1c1
Sequence:CCGGCCTCAGGCTATGAGTGCCATACTCGAGTATGGCACTCATAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-542s1c1
Sequence:CCGGCCAACCATGGACAGTGTGTTACTCGAGTAACACACTGTCCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-604s1c1
Sequence:CCGGCTTCACAAGGAATATCCAGAACTCGAGTTCTGGATATTCCTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023395.2-897s21c1
Sequence:CCGGGTCACACTCCATTCCACAGAACTCGAGTTCTGTGGAATGGAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023395.2-436s21c1
Sequence:CCGGGCTACAATGGCTGTGCCTATGCTCGAGCATAGGCACAGCCATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023395
WFDC1 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023395.1-753s1c1
Sequence:CCGGCCTTGGAAACAGCCAAAGAATCTCGAGATTCTTTGGCTGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-76s1c1
Sequence:CCGGGCTCTGAGTTTCCTGTTGCTACTCGAGTAGCAACAGGAAACTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-488s1c1
Sequence:CCGGCCTCAGGCTATGAGTGCCATACTCGAGTATGGCACTCATAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-542s1c1
Sequence:CCGGCCAACCATGGACAGTGTGTTACTCGAGTAACACACTGTCCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-604s1c1
Sequence:CCGGCTTCACAAGGAATATCCAGAACTCGAGTTCTGGATATTCCTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023395.2-897s21c1
Sequence:CCGGGTCACACTCCATTCCACAGAACTCGAGTTCTGTGGAATGGAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023395.2-436s21c1
Sequence:CCGGGCTACAATGGCTGTGCCTATGCTCGAGCATAGGCACAGCCATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023395
WFDC1 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023395.1-753s1c1
Sequence:CCGGCCTTGGAAACAGCCAAAGAATCTCGAGATTCTTTGGCTGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-76s1c1
Sequence:CCGGGCTCTGAGTTTCCTGTTGCTACTCGAGTAGCAACAGGAAACTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-488s1c1
Sequence:CCGGCCTCAGGCTATGAGTGCCATACTCGAGTATGGCACTCATAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-542s1c1
Sequence:CCGGCCAACCATGGACAGTGTGTTACTCGAGTAACACACTGTCCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023395.1-604s1c1
Sequence:CCGGCTTCACAAGGAATATCCAGAACTCGAGTTCTGGATATTCCTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023395.2-897s21c1
Sequence:CCGGGTCACACTCCATTCCACAGAACTCGAGTTCTGTGGAATGGAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023395.2-436s21c1
Sequence:CCGGGCTACAATGGCTGTGCCTATGCTCGAGCATAGGCACAGCCATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021197
WFDC1 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021197.2-863s1c1
Sequence:CCGGGCAAGAACATTCCTCTACTTTCTCGAGAAAGTAGAGGAATGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-750s1c1
Sequence:CCGGCCTACGACACAAACTTTACAACTCGAGTTGTAAAGTTTGTGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-787s1c1
Sequence:CCGGGACTCAAAGAATGTGGCAGAACTCGAGTTCTGCCACATTCTTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-265s1c1
Sequence:CCGGTCTGCCAAGAATATCTGGAAACTCGAGTTTCCAGATATTCTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-778s1c1
Sequence:CCGGCCAGAAGGTGACTCAAAGAATCTCGAGATTCTTTGAGTCACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021197.2-1084s21c1
Sequence:CCGGTGCAGCTCCACGAGACCTTTACTCGAGTAAAGGTCTCGTGGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021197.2-1158s21c1
Sequence:CCGGCAAGGCTCAGCATCTTGATATCTCGAGATATCAAGATGCTGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021197.2-822s21c1
Sequence:CCGGACAGAAGCACTTTCAGTAAAGCTCGAGCTTTACTGAAAGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021197
WFDC1 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021197.2-863s1c1
Sequence:CCGGGCAAGAACATTCCTCTACTTTCTCGAGAAAGTAGAGGAATGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-750s1c1
Sequence:CCGGCCTACGACACAAACTTTACAACTCGAGTTGTAAAGTTTGTGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-787s1c1
Sequence:CCGGGACTCAAAGAATGTGGCAGAACTCGAGTTCTGCCACATTCTTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-265s1c1
Sequence:CCGGTCTGCCAAGAATATCTGGAAACTCGAGTTTCCAGATATTCTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-778s1c1
Sequence:CCGGCCAGAAGGTGACTCAAAGAATCTCGAGATTCTTTGAGTCACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021197.2-1084s21c1
Sequence:CCGGTGCAGCTCCACGAGACCTTTACTCGAGTAAAGGTCTCGTGGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021197.2-1158s21c1
Sequence:CCGGCAAGGCTCAGCATCTTGATATCTCGAGATATCAAGATGCTGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021197.2-822s21c1
Sequence:CCGGACAGAAGCACTTTCAGTAAAGCTCGAGCTTTACTGAAAGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021197
WFDC1 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021197.2-863s1c1
Sequence:CCGGGCAAGAACATTCCTCTACTTTCTCGAGAAAGTAGAGGAATGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-750s1c1
Sequence:CCGGCCTACGACACAAACTTTACAACTCGAGTTGTAAAGTTTGTGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-787s1c1
Sequence:CCGGGACTCAAAGAATGTGGCAGAACTCGAGTTCTGCCACATTCTTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-265s1c1
Sequence:CCGGTCTGCCAAGAATATCTGGAAACTCGAGTTTCCAGATATTCTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021197.2-778s1c1
Sequence:CCGGCCAGAAGGTGACTCAAAGAATCTCGAGATTCTTTGAGTCACCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021197.2-1084s21c1
Sequence:CCGGTGCAGCTCCACGAGACCTTTACTCGAGTAAAGGTCTCGTGGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021197.2-1158s21c1
Sequence:CCGGCAAGGCTCAGCATCTTGATATCTCGAGATATCAAGATGCTGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021197.2-822s21c1
Sequence:CCGGACAGAAGCACTTTCAGTAAAGCTCGAGCTTTACTGAAAGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks