EMAIL THIS PAGE TO A FRIEND

WFDC2

WAP four-disulfide core domain 2

Synonyms: EDDM4 HE4 WAP5 dJ461P17.6
Gene ID:
Human(10406) Summary: This gene encodes a protein that is a member of the WFDC domain family. The WFDC domain, or WAP Signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is expressed in pulmonary epithelial cells, and was also found to be expressed in some ovarian cancers. The encoded protein is a small secretory protein, which may be involved in sperm maturation. [provided by RefSeq, Jul 2008]
Mouse(67701) WAP four-disulfide core domain 2
Rat(286888) WAP four-disulfide core domain 2
naked mole-rat(101706689) WAP four-disulfide core domain 2
Domestic Rabbit(100009206) WAP four-disulfide core domain 2
cow(618044) WAP four-disulfide core domain 2
sheep(101111308) WAP four-disulfide core domain 2
Zebrafish(556600) WAP four-disulfide core domain 2
chicken(419300) WAP four-disulfide core domain 2
dog(403919) WAP four-disulfide core domain 2
domestic cat(101087912) WAP four-disulfide core domain 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1501 Human HE4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006103 Rosetta Predictions human pricing
NM_080734 Rosetta Predictions human pricing
NM_080735 Rosetta Predictions human pricing
NM_080736 Rosetta Predictions human pricing
NM_173109 Rosetta Predictions rat pricing
NM_026323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043969 predicted 325
2 SASI_Hs01_00043970 predicted 324
3 SASI_Hs01_00043971 predicted 334
4 SASI_Hs01_00043973 predicted 329
5 SASI_Hs01_00043974 predicted 323
6 SASI_Hs01_00043975 predicted 325
7 SASI_Hs02_00340889 predicted 213
8 SASI_Hs02_00340890 predicted 332
9 SASI_Hs02_00340891 predicted 306
10 SASI_Hs01_00043978 predicted 232
11 SASI_Hs01_00043972 predicted 235
12 SASI_Hs01_00043976 predicted 242
13 SASI_Hs01_00043977 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186195 predicted 186
2 SASI_Hs01_00186196 predicted 201
3 SASI_Hs01_00186197 predicted 93
4 SASI_Hs01_00186198 predicted 192
5 SASI_Hs01_00186199 predicted 87
6 SASI_Hs01_00186200 predicted 237
7 SASI_Hs01_00186201 predicted 192
8 SASI_Hs01_00186202 predicted 91
9 SASI_Hs01_00186203 predicted 228
10 SASI_Hs01_00186204 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082589 predicted 176
2 SASI_Hs01_00082590 predicted 188
3 SASI_Hs01_00082591 predicted 31
4 SASI_Hs01_00082592 predicted 72
5 SASI_Hs01_00082593 predicted 63
6 SASI_Hs01_00082594 predicted 176
7 SASI_Hs01_00082595 predicted 67
8 SASI_Hs01_00082596 predicted 233
9 SASI_Hs01_00082597 predicted 175
10 SASI_Hs01_00082598 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221178 predicted 200
2 SASI_Hs01_00221179 predicted 175
3 SASI_Hs01_00221180 predicted 77
4 SASI_Hs01_00221181 predicted 323
5 SASI_Hs01_00221182 predicted 188
6 SASI_Hs01_00221183 predicted 169
7 SASI_Hs01_00221184 predicted 164
8 SASI_Hs01_00221185 predicted 187
9 SASI_Hs01_00221186 predicted 330
10 SASI_Hs01_00221187 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100568 predicted 323
2 SASI_Rn01_00100570 predicted 459
3 SASI_Rn02_00269259 predicted 459
4 SASI_Rn02_00269260 predicted 359
5 SASI_Rn01_00100571 predicted 374
6 SASI_Rn01_00100572 predicted 231
7 SASI_Rn01_00100573 predicted 469
8 SASI_Rn01_00100574 predicted 334
9 SASI_Rn01_00100575 predicted 349
10 SASI_Rn01_00100576 predicted 299
11 SASI_Rn01_00100569 predicted 362
12 SASI_Rn01_00100577 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058800 predicted 239
2 SASI_Mm01_00058801 predicted 303
3 SASI_Mm01_00058802 predicted 249
4 SASI_Mm01_00058803 predicted 270
5 SASI_Mm01_00058804 predicted 331
6 SASI_Mm01_00058805 predicted 370
7 SASI_Mm01_00058806 predicted 246
8 SASI_Mm01_00058807 predicted 303
9 SASI_Mm01_00058808 predicted 267
10 SASI_Mm01_00058809 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026323
WFDC2 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026323.1-558s1c1
Sequence:CCGGAGGAATGGAGAGAGGTTGTTTCTCGAGAAACAACCTCTCTCCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-122s1c1
Sequence:CCGGCCAGCTTGAACCAATTACGGACTCGAGTCCGTAATTGGTTCAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-280s1c1
Sequence:CCGGAGACTGGGACTACTACTCAATCTCGAGATTGAGTAGTAGTCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-251s1c1
Sequence:CCGGGCTCTCAGGGACAGATACTAACTCGAGTTAGTATCTGTCCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-464s1c1
Sequence:CCGGCCAGTGTTCTGGCAACATGAACTCGAGTTCATGTTGCCAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026323
WFDC2 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026323.1-558s1c1
Sequence:CCGGAGGAATGGAGAGAGGTTGTTTCTCGAGAAACAACCTCTCTCCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-122s1c1
Sequence:CCGGCCAGCTTGAACCAATTACGGACTCGAGTCCGTAATTGGTTCAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-280s1c1
Sequence:CCGGAGACTGGGACTACTACTCAATCTCGAGATTGAGTAGTAGTCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-251s1c1
Sequence:CCGGGCTCTCAGGGACAGATACTAACTCGAGTTAGTATCTGTCCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-464s1c1
Sequence:CCGGCCAGTGTTCTGGCAACATGAACTCGAGTTCATGTTGCCAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026323
WFDC2 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026323.1-558s1c1
Sequence:CCGGAGGAATGGAGAGAGGTTGTTTCTCGAGAAACAACCTCTCTCCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-122s1c1
Sequence:CCGGCCAGCTTGAACCAATTACGGACTCGAGTCCGTAATTGGTTCAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-280s1c1
Sequence:CCGGAGACTGGGACTACTACTCAATCTCGAGATTGAGTAGTAGTCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-251s1c1
Sequence:CCGGGCTCTCAGGGACAGATACTAACTCGAGTTAGTATCTGTCCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026323.1-464s1c1
Sequence:CCGGCCAGTGTTCTGGCAACATGAACTCGAGTTCATGTTGCCAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006103
WFDC2 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-380s1c1
Sequence:CCGGGTGTCCTGTGTCACTCCCAATCTCGAGATTGGGAGTGACACAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-237s1c1
Sequence:CCGGGCCTTCTCTGCCCAAATGATACTCGAGTATCATTTGGGCAGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-149s1c1
Sequence:CCGGGCTGACCAGAACTGCACGCAACTCGAGTTGCGTGCAGTTCTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-347s1c1
Sequence:CCGGCAGATGAAATGCTGCCGCAATCTCGAGATTGCGGCAGCATTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-246s1c1
Sequence:CCGGGCCCAAATGATAAGGAGGGTTCTCGAGAACCCTCCTTATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-86s21c1
Sequence:CCGGTTCGGCTTCACCCTAGTCTCACTCGAGTGAGACTAGGGTGAAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-270s21c1
Sequence:CCGGCCCAGGTGAACATTAACTTTCCTCGAGGAAAGTTAATGTTCACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-235s21c1
Sequence:CCGGCTGCTCTCTGCCCAATGATAACTCGAGTTATCATTGGGCAGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006103
WFDC2 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-380s1c1
Sequence:CCGGGTGTCCTGTGTCACTCCCAATCTCGAGATTGGGAGTGACACAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-237s1c1
Sequence:CCGGGCCTTCTCTGCCCAAATGATACTCGAGTATCATTTGGGCAGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-149s1c1
Sequence:CCGGGCTGACCAGAACTGCACGCAACTCGAGTTGCGTGCAGTTCTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-347s1c1
Sequence:CCGGCAGATGAAATGCTGCCGCAATCTCGAGATTGCGGCAGCATTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-246s1c1
Sequence:CCGGGCCCAAATGATAAGGAGGGTTCTCGAGAACCCTCCTTATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-86s21c1
Sequence:CCGGTTCGGCTTCACCCTAGTCTCACTCGAGTGAGACTAGGGTGAAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-270s21c1
Sequence:CCGGCCCAGGTGAACATTAACTTTCCTCGAGGAAAGTTAATGTTCACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-235s21c1
Sequence:CCGGCTGCTCTCTGCCCAATGATAACTCGAGTTATCATTGGGCAGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006103
WFDC2 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-380s1c1
Sequence:CCGGGTGTCCTGTGTCACTCCCAATCTCGAGATTGGGAGTGACACAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-237s1c1
Sequence:CCGGGCCTTCTCTGCCCAAATGATACTCGAGTATCATTTGGGCAGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-149s1c1
Sequence:CCGGGCTGACCAGAACTGCACGCAACTCGAGTTGCGTGCAGTTCTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-347s1c1
Sequence:CCGGCAGATGAAATGCTGCCGCAATCTCGAGATTGCGGCAGCATTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006103.2-246s1c1
Sequence:CCGGGCCCAAATGATAAGGAGGGTTCTCGAGAACCCTCCTTATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-86s21c1
Sequence:CCGGTTCGGCTTCACCCTAGTCTCACTCGAGTGAGACTAGGGTGAAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-270s21c1
Sequence:CCGGCCCAGGTGAACATTAACTTTCCTCGAGGAAAGTTAATGTTCACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006103.3-235s21c1
Sequence:CCGGCTGCTCTCTGCCCAATGATAACTCGAGTTATCATTGGGCAGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks