EMAIL THIS PAGE TO A FRIEND

WFDC3

WAP four-disulfide core domain 3

Synonyms: WAP14 dJ447F3.3
Gene ID:
Human(140686) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains four WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Alternatively spliced transcript variants have been observed but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(71856) WAP four-disulfide core domain 3
Rat(296366) WAP four-disulfide core domain 3
domestic cat(101086385) WAP four-disulfide core domain 3
dog(100686167) WAP four-disulfide core domain 3
cow(505523) WAP four-disulfide core domain 3
sheep(101114545) WAP four-disulfide core domain 3
naked mole-rat(101725337) WAP four-disulfide core domain 3
domestic guinea pig(100727382) WAP four-disulfide core domain 3
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080614 Rosetta Predictions human pricing
NM_181522 Rosetta Predictions human pricing
NM_181525 Rosetta Predictions human pricing
NM_181530 Rosetta Predictions human pricing
NM_001106541 Rosetta Predictions rat pricing
NM_027961 Rosetta Predictions mouse pricing
XM_355365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154734 predicted 412
2 SASI_Hs02_00362362 predicted 616
3 SASI_Hs01_00154735 predicted 743
4 SASI_Hs01_00154736 predicted 322
5 SASI_Hs01_00154737 predicted 726
6 SASI_Hs01_00154738 predicted 345
7 SASI_Hs02_00362363 predicted 737
8 SASI_Hs01_00154741 predicted 394
9 SASI_Hs02_00362364 predicted 735
10 SASI_Hs01_00154742 predicted 357
11 SASI_Hs01_00154739 predicted 737
12 SASI_Hs01_00154740 predicted 409
13 SASI_Hs01_00154743 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135173 predicted 548
2 SASI_Hs01_00135174 predicted 457
3 SASI_Hs01_00135175 predicted 515
4 SASI_Hs01_00135176 predicted 507
5 SASI_Hs01_00135177 predicted 514
6 SASI_Hs01_00135178 predicted 526
7 SASI_Hs01_00135179 predicted 521
8 SASI_Hs01_00135180 predicted 550
9 SASI_Hs01_00135181 predicted 547
10 SASI_Hs01_00135182 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102867 predicted 539
2 SASI_Hs01_00102868 predicted 445
3 SASI_Hs01_00102869 predicted 510
4 SASI_Hs01_00102870 predicted 491
5 SASI_Hs01_00102871 predicted 500
6 SASI_Hs01_00102872 predicted 504
7 SASI_Hs01_00102873 predicted 510
8 SASI_Hs01_00102874 predicted 541
9 SASI_Hs01_00102875 predicted 542
10 SASI_Hs01_00102876 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173007 predicted 277
2 SASI_Hs01_00173008 predicted 236
3 SASI_Hs01_00173009 predicted 227
4 SASI_Hs01_00173010 predicted 270
5 SASI_Hs01_00173011 predicted 270
6 SASI_Hs01_00173012 predicted 243
7 SASI_Hs01_00173013 predicted 247
8 SASI_Hs01_00173014 predicted 241
9 SASI_Hs01_00173015 predicted 274
10 SASI_Hs01_00173016 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219968 predicted 588
2 SASI_Rn02_00219969 predicted 311
3 SASI_Rn02_00219970 predicted 273
4 SASI_Rn02_00219971 predicted 431
5 SASI_Rn02_00219972 predicted 687
6 SASI_Rn02_00219973 predicted 678
7 SASI_Rn02_00219974 predicted 209
8 SASI_Rn02_00219975 predicted 232
9 SASI_Rn02_00219976 predicted 411
10 SASI_Rn02_00219977 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332989 predicted 522
2 SASI_Mm02_00332990 predicted 580
3 SASI_Mm02_00332991 predicted 509
4 SASI_Mm02_00332992 predicted 277
5 SASI_Mm02_00332993 predicted 549
6 SASI_Mm02_00332994 predicted 554
7 SASI_Mm02_00332995 predicted 235
8 SASI_Mm02_00332996 predicted 389
9 SASI_Mm02_00332997 predicted 449
10 SASI_Mm02_00332998 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215768 predicted 582
2 SASI_Mm01_00215769 predicted 623
3 SASI_Mm01_00215770 predicted 328
4 SASI_Mm01_00215771 predicted 603
5 SASI_Mm01_00215772 predicted 608
6 SASI_Mm01_00215773 predicted 278
7 SASI_Mm01_00215774 predicted 680
8 SASI_Mm01_00215775 predicted 430
9 SASI_Mm01_00215776 predicted 501
10 SASI_Mm01_00215777 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080614
WFDC3 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-211s21c1
Sequence:CCGGCTGTGCCAGGGTGATGAATTGCTCGAGCAATTCATCACCCTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-440s1c2
Sequence:CCGGTGGCAGAGTTTGGTGGTGAATCTCGAGATTCACCACCAAACTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-305s21c1
Sequence:CCGGGAGATTGCCCTAGGGTTATTCCTCGAGGAATAACCCTAGGGCAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-772s21c1
Sequence:CCGGGTGCCCTAGCTGTGCTGATTTCTCGAGAAATCAGCACAGCTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080614.1-800s1c1
Sequence:CCGGGCTTCTTTGGTAATTCTGGAACTCGAGTTCCAGAATTACCAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-410s1c1
Sequence:CCGGGCTGTGTAGTCCCAATCTCTACTCGAGTAGAGATTGGGACTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-376s1c1
Sequence:CCGGGTAAAGAAATGCTGCACGCTTCTCGAGAAGCGTGCAGCATTTCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-742s1c1
Sequence:CCGGGTGAGGTCTGATTCCGAATTACTCGAGTAATTCGGAATCAGACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080614
WFDC3 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-211s21c1
Sequence:CCGGCTGTGCCAGGGTGATGAATTGCTCGAGCAATTCATCACCCTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-440s1c2
Sequence:CCGGTGGCAGAGTTTGGTGGTGAATCTCGAGATTCACCACCAAACTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-305s21c1
Sequence:CCGGGAGATTGCCCTAGGGTTATTCCTCGAGGAATAACCCTAGGGCAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-772s21c1
Sequence:CCGGGTGCCCTAGCTGTGCTGATTTCTCGAGAAATCAGCACAGCTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080614.1-800s1c1
Sequence:CCGGGCTTCTTTGGTAATTCTGGAACTCGAGTTCCAGAATTACCAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-410s1c1
Sequence:CCGGGCTGTGTAGTCCCAATCTCTACTCGAGTAGAGATTGGGACTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-376s1c1
Sequence:CCGGGTAAAGAAATGCTGCACGCTTCTCGAGAAGCGTGCAGCATTTCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-742s1c1
Sequence:CCGGGTGAGGTCTGATTCCGAATTACTCGAGTAATTCGGAATCAGACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080614
WFDC3 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-211s21c1
Sequence:CCGGCTGTGCCAGGGTGATGAATTGCTCGAGCAATTCATCACCCTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-440s1c2
Sequence:CCGGTGGCAGAGTTTGGTGGTGAATCTCGAGATTCACCACCAAACTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-305s21c1
Sequence:CCGGGAGATTGCCCTAGGGTTATTCCTCGAGGAATAACCCTAGGGCAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080614.1-772s21c1
Sequence:CCGGGTGCCCTAGCTGTGCTGATTTCTCGAGAAATCAGCACAGCTAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080614.1-800s1c1
Sequence:CCGGGCTTCTTTGGTAATTCTGGAACTCGAGTTCCAGAATTACCAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-410s1c1
Sequence:CCGGGCTGTGTAGTCCCAATCTCTACTCGAGTAGAGATTGGGACTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-376s1c1
Sequence:CCGGGTAAAGAAATGCTGCACGCTTCTCGAGAAGCGTGCAGCATTTCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080614.1-742s1c1
Sequence:CCGGGTGAGGTCTGATTCCGAATTACTCGAGTAATTCGGAATCAGACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027961
WFDC3 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-282s21c1
Sequence:CCGGAGCTGTGTACCGGAGACGAATCTCGAGATTCGTCTCCGGTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-427s21c1
Sequence:CCGGGATGGATGAGAACTGTCAATCCTCGAGGATTGACAGTTCTCATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027961.1-633s21c1
Sequence:CCGGTGACACTCCCTGGAGTATCAGCTCGAGCTGATACTCCAGGGAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-525s21c1
Sequence:CCGGCCAACCTGACTGATGGCTTTACTCGAGTAAAGCCATCAGTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-395s21c1
Sequence:CCGGATCCTGGTAGGCCTGTGTATTCTCGAGAATACACAGGCCTACCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027961
WFDC3 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-282s21c1
Sequence:CCGGAGCTGTGTACCGGAGACGAATCTCGAGATTCGTCTCCGGTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-427s21c1
Sequence:CCGGGATGGATGAGAACTGTCAATCCTCGAGGATTGACAGTTCTCATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027961.1-633s21c1
Sequence:CCGGTGACACTCCCTGGAGTATCAGCTCGAGCTGATACTCCAGGGAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-525s21c1
Sequence:CCGGCCAACCTGACTGATGGCTTTACTCGAGTAAAGCCATCAGTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-395s21c1
Sequence:CCGGATCCTGGTAGGCCTGTGTATTCTCGAGAATACACAGGCCTACCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027961
WFDC3 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-282s21c1
Sequence:CCGGAGCTGTGTACCGGAGACGAATCTCGAGATTCGTCTCCGGTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-427s21c1
Sequence:CCGGGATGGATGAGAACTGTCAATCCTCGAGGATTGACAGTTCTCATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027961.1-633s21c1
Sequence:CCGGTGACACTCCCTGGAGTATCAGCTCGAGCTGATACTCCAGGGAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-525s21c1
Sequence:CCGGCCAACCTGACTGATGGCTTTACTCGAGTAAAGCCATCAGTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027961.1-395s21c1
Sequence:CCGGATCCTGGTAGGCCTGTGTATTCTCGAGAATACACAGGCCTACCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks