EMAIL THIS PAGE TO A FRIEND

WFDC5

WAP four-disulfide core domain 5

Synonyms: PRG5 WAP1 dJ211D12.5
UniProtKB ID: Q8TCV5, Q5H981, Q6UWE4
Gene ID:
Human(149708) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. Most WFDC proteins contain only one WFDC domain, and this encoded protein contains two WFDC domains. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the centromeric cluster. [provided by RefSeq, Jul 2008]
Mouse(209232) WAP four-disulfide core domain 5
Rat(296352) WAP four-disulfide core domain 5
domestic guinea pig(100721977) WAP four-disulfide core domain 5
naked mole-rat(101708136) WAP four-disulfide core domain 5
cow(517054) WAP four-disulfide core domain 5
sheep(101110696) WAP four-disulfide core domain 5
dog(610999) WAP four-disulfide core domain 5
domestic cat(101089430) WAP four-disulfide core domain 5
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145652 Rosetta Predictions human pricing
NM_001106538 Rosetta Predictions rat pricing
XM_215934 Rosetta Predictions rat pricing
NM_145369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230068 predicted 441
2 SASI_Hs01_00230069 predicted 550
3 SASI_Hs01_00230070 predicted 435
4 SASI_Hs02_00365276 predicted 557
5 SASI_Hs01_00230072 predicted 368
6 SASI_Hs01_00230073 predicted 553
7 SASI_Hs01_00230074 predicted 373
8 SASI_Hs01_00230075 predicted 438
9 SASI_Hs01_00230077 predicted 353
10 SASI_Hs02_00365277 predicted 481
11 SASI_Hs01_00230071 predicted 237
12 SASI_Hs01_00230076 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219938 predicted 559
2 SASI_Rn02_00219939 predicted 454
3 SASI_Rn02_00219940 predicted 380
4 SASI_Rn02_00219941 predicted 793
5 SASI_Rn02_00219942 predicted 756
6 SASI_Rn02_00219943 predicted 743
7 SASI_Rn02_00219944 predicted 454
8 SASI_Rn02_00219945 predicted 489
9 SASI_Rn02_00219946 predicted 337
10 SASI_Rn02_00219947 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00157130 predicted 361
2 SASI_Rn01_00157131 predicted 271
3 SASI_Rn01_00157132 predicted 316
4 SASI_Rn01_00157133 predicted 254
5 SASI_Rn01_00157134 predicted 268
6 SASI_Rn01_00157135 predicted 267
7 SASI_Rn01_00157136 predicted 206
8 SASI_Rn01_00157137 predicted 367
9 SASI_Rn01_00157138 predicted 269
10 SASI_Rn01_00157139 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171092 predicted 657
2 SASI_Mm02_00340647 predicted 728
3 SASI_Mm01_00171094 predicted 622
4 SASI_Mm01_00171095 predicted 219
5 SASI_Mm01_00171096 predicted 358
6 SASI_Mm01_00171097 predicted 755
7 SASI_Mm01_00171098 predicted 474
8 SASI_Mm01_00171099 predicted 294
9 SASI_Mm01_00171101 predicted 752
10 SASI_Mm02_00340648 predicted 750
11 SASI_Mm01_00171093 predicted 767
12 SASI_Mm01_00171100 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145652
WFDC5 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145652.2-812s1c1
Sequence:CCGGCCAACCATCCAGAATGAATATCTCGAGATATTCATTCTGGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-238s1c1
Sequence:CCGGCCAGTGTCCCTTGACCAGGAACTCGAGTTCCTGGTCAAGGGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-150s1c1
Sequence:CCGGGCAGGAAGAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-355s1c1
Sequence:CCGGGAACCACCTGTGTCACAAGGACTCGAGTCCTTGTGACACAGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-259s1c1
Sequence:CCGGGTGCTGCTACAGAGCTTGCTTCTCGAGAAGCAAGCTCTGTAGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145652.2-433s21c1
Sequence:CCGGGGATCCTGCCAGAGGCTAATTCTCGAGAATTAGCCTCTGGCAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145652.2-560s21c1
Sequence:CCGGGTGGTTCCAGCCTTCTGATAACTCGAGTTATCAGAAGGCTGGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145652.2-625s21c1
Sequence:CCGGTTCTCCTCCTGGGAGTCAAAGCTCGAGCTTTGACTCCCAGGAGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145652
WFDC5 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145652.2-812s1c1
Sequence:CCGGCCAACCATCCAGAATGAATATCTCGAGATATTCATTCTGGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-238s1c1
Sequence:CCGGCCAGTGTCCCTTGACCAGGAACTCGAGTTCCTGGTCAAGGGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-150s1c1
Sequence:CCGGGCAGGAAGAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-355s1c1
Sequence:CCGGGAACCACCTGTGTCACAAGGACTCGAGTCCTTGTGACACAGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-259s1c1
Sequence:CCGGGTGCTGCTACAGAGCTTGCTTCTCGAGAAGCAAGCTCTGTAGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145652.2-433s21c1
Sequence:CCGGGGATCCTGCCAGAGGCTAATTCTCGAGAATTAGCCTCTGGCAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145652.2-560s21c1
Sequence:CCGGGTGGTTCCAGCCTTCTGATAACTCGAGTTATCAGAAGGCTGGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145652.2-625s21c1
Sequence:CCGGTTCTCCTCCTGGGAGTCAAAGCTCGAGCTTTGACTCCCAGGAGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145652
WFDC5 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145652.2-812s1c1
Sequence:CCGGCCAACCATCCAGAATGAATATCTCGAGATATTCATTCTGGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-238s1c1
Sequence:CCGGCCAGTGTCCCTTGACCAGGAACTCGAGTTCCTGGTCAAGGGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-150s1c1
Sequence:CCGGGCAGGAAGAAGGGAGAGAAATCTCGAGATTTCTCTCCCTTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-355s1c1
Sequence:CCGGGAACCACCTGTGTCACAAGGACTCGAGTCCTTGTGACACAGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145652.2-259s1c1
Sequence:CCGGGTGCTGCTACAGAGCTTGCTTCTCGAGAAGCAAGCTCTGTAGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145652.2-433s21c1
Sequence:CCGGGGATCCTGCCAGAGGCTAATTCTCGAGAATTAGCCTCTGGCAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145652.2-560s21c1
Sequence:CCGGGTGGTTCCAGCCTTCTGATAACTCGAGTTATCAGAAGGCTGGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145652.2-625s21c1
Sequence:CCGGTTCTCCTCCTGGGAGTCAAAGCTCGAGCTTTGACTCCCAGGAGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145369
WFDC5 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145369.1-767s1c1
Sequence:CCGGCCAGTGTTATATCTCTCTGTACTCGAGTACAGAGAGATATAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-225s1c1
Sequence:CCGGCCTCCTGATCAGTGCTTGAATCTCGAGATTCAAGCACTGATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-200s1c1
Sequence:CCGGCGATGGACTCTGCAACCAGAACTCGAGTTCTGGTTGCAGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-146s1c1
Sequence:CCGGGCCTGTTGCCTTGTGTAGAAACTCGAGTTTCTACACAAGGCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-313s1c1
Sequence:CCGGTCTTTGTAAAGTCGGGCAAATCTCGAGATTTGCCCGACTTTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145369
WFDC5 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145369.1-767s1c1
Sequence:CCGGCCAGTGTTATATCTCTCTGTACTCGAGTACAGAGAGATATAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-225s1c1
Sequence:CCGGCCTCCTGATCAGTGCTTGAATCTCGAGATTCAAGCACTGATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-200s1c1
Sequence:CCGGCGATGGACTCTGCAACCAGAACTCGAGTTCTGGTTGCAGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-146s1c1
Sequence:CCGGGCCTGTTGCCTTGTGTAGAAACTCGAGTTTCTACACAAGGCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-313s1c1
Sequence:CCGGTCTTTGTAAAGTCGGGCAAATCTCGAGATTTGCCCGACTTTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145369
WFDC5 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145369.1-767s1c1
Sequence:CCGGCCAGTGTTATATCTCTCTGTACTCGAGTACAGAGAGATATAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-225s1c1
Sequence:CCGGCCTCCTGATCAGTGCTTGAATCTCGAGATTCAAGCACTGATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-200s1c1
Sequence:CCGGCGATGGACTCTGCAACCAGAACTCGAGTTCTGGTTGCAGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-146s1c1
Sequence:CCGGGCCTGTTGCCTTGTGTAGAAACTCGAGTTTCTACACAAGGCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145369.1-313s1c1
Sequence:CCGGTCTTTGTAAAGTCGGGCAAATCTCGAGATTTGCCCGACTTTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks