EMAIL THIS PAGE TO A FRIEND

WFDC6

WAP four-disulfide core domain 6

Synonyms: C20orf171 WAP6 dJ461P17.11
Species: Human WFDC6(140870)
UniProtKB ID: Q9BQY6, Q3MJ23, Q5JYQ4, Q8NFV6
Gene ID:
Human(140870) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Read-through transcription exists between this gene and the upstream SPINLW1 (serine peptidase inhibitor-like, with Kunitz and WAP domains 1) gene. [provided by RefSeq, Nov 2010]
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080827 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027176 predicted 388
2 SASI_Hs01_00027177 predicted 332
3 SASI_Hs01_00027178 predicted 383
4 SASI_Hs01_00027179 predicted 278
5 SASI_Hs01_00027180 predicted 321
6 SASI_Hs01_00027181 predicted 307
7 SASI_Hs02_00362612 predicted 347
8 SASI_Hs01_00027182 predicted 303
9 SASI_Hs01_00027184 predicted 269
10 SASI_Hs01_00027185 predicted 207
11 SASI_Hs01_00027183 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080827
WFDC6 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080827.1-429s21c1
Sequence:CCGGACCTTGGCTGTTCCAGAAACTCTCGAGAGTTTCTGGAACAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080827.1-350s21c1
Sequence:CCGGCCTCCAGGATTTGGCTCATAACTCGAGTTATGAGCCAAATCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080827.1-173s21c1
Sequence:CCGGCTTGGCAAGCCGTGTCCCAAACTCGAGTTTGGGACACGGCTTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080827.1-392s1c1
Sequence:CCGGGCCTGATTGATGCTCCAAATTCTCGAGAATTTGGAGCATCAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-313s1c1
Sequence:CCGGCAGCCTTACTTTATACCATAACTCGAGTTATGGTATAAAGTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-218s1c1
Sequence:CCGGGAAATAGACCAGTGTACCAAACTCGAGTTTGGTACACTGGTCTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-201s1c1
Sequence:CCGGTGGAATGCGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-277s1c1
Sequence:CCGGCAGCCGTGGAAAGAAATGTTTCTCGAGAAACATTTCTTTCCACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080827
WFDC6 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080827.1-429s21c1
Sequence:CCGGACCTTGGCTGTTCCAGAAACTCTCGAGAGTTTCTGGAACAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080827.1-350s21c1
Sequence:CCGGCCTCCAGGATTTGGCTCATAACTCGAGTTATGAGCCAAATCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080827.1-173s21c1
Sequence:CCGGCTTGGCAAGCCGTGTCCCAAACTCGAGTTTGGGACACGGCTTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080827.1-392s1c1
Sequence:CCGGGCCTGATTGATGCTCCAAATTCTCGAGAATTTGGAGCATCAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-313s1c1
Sequence:CCGGCAGCCTTACTTTATACCATAACTCGAGTTATGGTATAAAGTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-218s1c1
Sequence:CCGGGAAATAGACCAGTGTACCAAACTCGAGTTTGGTACACTGGTCTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-201s1c1
Sequence:CCGGTGGAATGCGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-277s1c1
Sequence:CCGGCAGCCGTGGAAAGAAATGTTTCTCGAGAAACATTTCTTTCCACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080827
WFDC6 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080827.1-429s21c1
Sequence:CCGGACCTTGGCTGTTCCAGAAACTCTCGAGAGTTTCTGGAACAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080827.1-350s21c1
Sequence:CCGGCCTCCAGGATTTGGCTCATAACTCGAGTTATGAGCCAAATCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080827.1-173s21c1
Sequence:CCGGCTTGGCAAGCCGTGTCCCAAACTCGAGTTTGGGACACGGCTTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080827.1-392s1c1
Sequence:CCGGGCCTGATTGATGCTCCAAATTCTCGAGAATTTGGAGCATCAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-313s1c1
Sequence:CCGGCAGCCTTACTTTATACCATAACTCGAGTTATGGTATAAAGTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-218s1c1
Sequence:CCGGGAAATAGACCAGTGTACCAAACTCGAGTTTGGTACACTGGTCTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-201s1c1
Sequence:CCGGTGGAATGCGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080827.1-277s1c1
Sequence:CCGGCAGCCGTGGAAAGAAATGTTTCTCGAGAAACATTTCTTTCCACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks